-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Silvia J. Park, et al.,
bioRxiv - Neuroscience 2023
Quote:
... eyecups were rinsed twice in PBS and embedded in 7% low-melt agarose (Precisionary, SKU VF-AGT-VM). The agarose-embedded eyecups were Vibratome-sectioned into 100 µm-thick slices (VT1200 ...
-
No products found
because this supplier's products are not listed.
Anastasiya Klebanovych, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the coding sequence of mNeonGreen was digested out from the mNeonGreen-EB3-7 plasmid (Allele Biotechnology, San Diego, CA) by BamHI/NotI ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and fractions 7 through 23 were collected using an automated fraction collector (Izon Science Ltd, 500 µL per fraction). A high sensitivity BCA assay (Pierce ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
D.K. Wilton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and a micromanipulator MM33 (Pipette.com 3-000-024-R). Mice were subsequently allowed to recover on a warm plate before being transferred back to their home cage ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Vanessa Krauspe, et al.,
bioRxiv - Microbiology 2020
Quote:
... Gels were stained using either 20 mM zinc sulfate-7-hydrate for reversible zinc staining of chromophores and/or InstantBlue(tm) Coomassie staining (Expedeon). Otherwise ...
-
No products found
because this supplier's products are not listed.
Marek M. Drozdz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and blocked in 3% bovine serum albumin (Proliant Biologicals, #68100) for one hour ...
-
No products found
because this supplier's products are not listed.
Yan Zou, Tian Chi,
bioRxiv - Cancer Biology 2021
Quote:
PBMCs from healthy donors were purchased from HemaCare (PB009C-3). To generate IKZF3-deficient CAR-T cells ...
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mounted on B3-3 magnetic bases (Mitegen, GB-B3-R). MicroRT tubing (Mitegen ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Jonatan Montpetit, et al.,
bioRxiv - Plant Biology 2022
Quote:
Arabidopsis thaliana seeds were surface sterilized and grown for 7 days on plates containing half-strength Murashige and Skoog (MS) medium without phosphate (Caisson Laboratories) supplemented with 75 μM or 1 mM KH2PO4 buffer (pH 5.8) ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
Cat# ACT-AVM3000-2,
USD $39.29/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Margaret M. McDaniel, Vitaly V. Ganusov,
bioRxiv - Immunology 2019
Quote:
... We fitted either recirculation model (panels A&C, see eqns. (3)–(9) ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Holly Linley, et al.,
bioRxiv - Immunology 2022
Quote:
... placed in 3 µm transwell inserts with 10 µg/ml anti-CD200R1 (OX131, Absolute Antibody), or rat IgG1 isotype control (eBioscience ...
-
No products found
because this supplier's products are not listed.
Sylvia Mutinda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the seeds were pre-germinated by adding 3 ml of 0.1 ppm GR24 (Chiralix, Nijmegen, Netherlands) and incubating overnight at 30 °C.
-
No products found
because this supplier's products are not listed.
Mary E. Herndon, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and Background Buster (Innovex Biosciences; Richmond, CA) was used to block non-specific staining ...
-
No products found
because this supplier's products are not listed.
Safwan K. Elkhatib, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and plasma were assessed using 3-CAT research ELISA (Rocky Mountain Diagnostics, BAE-5600, Colorado Springs, CO, USA) which had a corrected NE lower limit of detection of 30 pg/mL ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Ruikang Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the wells were washed 3 times with 250 μl of PBS + 0.05% Tween 20 (PBS-T, Accurate Chemical) and plates were blocked with 200 μl PBS-T + 5% Nonfat Dry Milk for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Nao Nishida-Aoki, Taranjit S. Gujral,
bioRxiv - Cancer Biology 2021
Quote:
Jurkat cells were washed with PBS and seeded onto a 24-well transwell culture insert with 3 µm pores (Celltreat Scientific Products ...
-
No products found
because this supplier's products are not listed.
Sujatha Muralidharan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A normal tissue TMA consisting of different organ specimens from 3 unique individuals was sourced from US Biomax (Cat# FDA999w1).
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Sonali Singh, et al.,
bioRxiv - Microbiology 2020
Quote:
... After washing three times with PBS blocking was carried out by adding 50 µl of 3% (w/v) bovine serum albumin (BSA) (80400-100, Alpha diagnostics) prepared in PBS ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Guneet Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary human cerebral cortex microvascular endothelial cells (Passage 3, 12 CPD in vitro, ACBRI 376) were procured from Cell Systems (Kirkland, WA 98034, USA). Brain microvascular endothelial cells (BMECs ...