-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Christopher T. Schafer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Methoxy e-Coelenterazine (Prolume Purple) was purchased from Nanolight Technologies (Prolume LTD ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1,2-bis-(aminophenoxy)- ethane-N,N,N’,N’-tetra-acetic acid-acetoxymethyl ester (BAPTA-AM, P4758, ApexBio), (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34 ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Divya Reddy, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2µg of antibody (Methyl cytosine: Diagenode MAb-006-100 ...
-
No products found
because this supplier's products are not listed.
Yan-Xue Li, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Methyl farnesoate (Echelon Biosciences, Utah, USA), farnesol (Sigma ...
-
No products found
because this supplier's products are not listed.
Marie-Laure Fogeron, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM amino acid mixture (average concentration of each amino acid 0.3 mM) and 0.1% (w/v) MNG-3 (Maltose Neopentyl Glycol-3, Anatrace). The feeding buffer contained 1x SUB-AMIX buffer (CellFree Sciences Japan) ...
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Kevin M. Cury, Richard Axel,
bioRxiv - Neuroscience 2021
Quote:
... 40 ml of substrates containing agarose and 3% acetic acid was poured into the lid or base of a 120 mm square petri dish (Greiner) and allowed to set for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Sharon Khuzwayo, et al.,
bioRxiv - Immunology 2020
Quote:
... The following morning plates were washed with 1x PBS-T before being coated with 3 μg/mL streptavidin-ALP secondary antibody (Mabtech, clone 7-B6-1) and incubated for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Andrea R. Dos Santos, et al.,
bioRxiv - Microbiology 2022
Quote:
... Citric acid kit: Citric Acid Assay Kit (Megazyme, product Code: K-CITR). Phosphate kit ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
M Bendahmane, et al.,
bioRxiv - Biophysics 2019
Quote:
... synaptotagmin-7 (rabbit polyclonal) are from Synaptic Systems.
-
No products found
because this supplier's products are not listed.
Jack A. Bibby, et al.,
bioRxiv - Immunology 2022
Quote:
... Arachidonic acid measurement was done using the human arachidonic acid ELISA kit (Novus biologicals) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Daniel A Chaves, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Paloma García Casas, et al.,
bioRxiv - Cell Biology 2023
Quote:
COS-7 cells were seeded on µ-Dish 35 mm (Ibidi), co-transfected 24 h later with plasmids encoding ER-Mit RspA-splitFAST and either ER-StayGold ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Joseph Deering, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and pixel size of 7 nm on a Continuum S imaging filter (Gatan). EELS elemental maps for carbon ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3-azido-7-hydroxycoumarin was purchased from Biosynth International Inc ...
-
No products found
because this supplier's products are not listed.
Rinaldo D. D’Souza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... into one of ten cortical areas and performing iontophoretic injections (3 µA, 7 s on/off cycle for 7 minutes; Midgard current source; Stoelting) of biotinylated dextran amine (BDA ...
-
No products found
because this supplier's products are not listed.
Roslyn A. Taylor, et al.,
bioRxiv - Cell Biology 2021
Quote:
... DOTA-NHS-ester (Macrocyclics, Dallas, Texas) was dissolved in the 0.1 M sodium phosphate buffer ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Lucas Tricoli, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Alcian blue solution was prepared using 3% glacial acetic acid (Amresco, 0714-500) and Alcian blue 8GX (Sigma ...
-
No products found
because this supplier's products are not listed.
Olivia D. Nigro, et al.,
bioRxiv - Microbiology 2021
Quote:
... mixed cellulose ester filters (47 mm, GN-6; Pall) and filters were placed face-up on the vibrio-selective medium CHROMagar Vibrio (DRG Intl.) ...
-
No products found
because this supplier's products are not listed.
Sang Soo Kim, et al.,
bioRxiv - Neuroscience 2019
Quote:
... GT1-7 cells were infected with the retrovirus encoding MC4R-3×HA using ViraDuctin™ Transduction Kit (Cell Biolabs, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Héloïse Grunchec, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Polyclonal anti-uL11K3me3 antibodies were generated in rabbit using a peptide corresponding to the first 16 amino acids of uL11 with methylated lysine 3 [PPK(me3)FDPTEVKLVYLRC] (Eurogentec). The serum was first loaded on a uL11K3me3 peptide affinity column which allowed to retain anti-uL11K3me3 and anti-uL11 antibodies ...
-
No products found
because this supplier's products are not listed.
David Forgacs, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were then washed 5 times with PBS/0.05% Tween20 prior to development with 100μL of 0.1% 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, Bioworld, Dublin, OH, USA) solution with 0.05% H2O2 for 18 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Shirsendu Ghosh, et al.,
bioRxiv - Biophysics 2020
Quote:
7) Glass bottom culture dish (MatTek, 35 mm petri dish ...
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Jeffrey L. Platt, et al.,
bioRxiv - Immunology 2021
Quote:
... The reaction was visualized by subsequent addition of 2,2′-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) substrate (Southern Biotech, #0202-01).
-
No products found
because this supplier's products are not listed.
Jordan E. Jones, Gregory D. D. Hurst,
bioRxiv - Evolutionary Biology 2022
Quote:
... to which 30 mL 10% Nipagin dissolved in 100% ethanol and 3 mL propionic acid was added) supplemented with a Flugs© (Flystuff, Genesee Scientific) moistened with honey water and allowed to mature and mate for at least 7 days prior to exposure to D ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
Tanay Ghosh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in QuantStudio 7 Flex (Applied Biosystems, ABI) machine ...
-
No products found
because this supplier's products are not listed.
Ziyu Zhao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brd4 (Bethyl Laboratories, A301-985A, lot#7), and H3K9me3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Christiane Geithe, et al.,
bioRxiv - Biochemistry 2021
Quote:
We used hybriwell chambers (16 wells, 7 mm x 7 mm x 0.05 mm; RD477991, Grace Bio-Labs, Oregon, USA) that were customized according to our needs ...
-
TeloCol®-3 is 50 mL of 3 mg/ml, type I bovine telocollagen solution for 2D coatings or 3D...
Cat# 5026-1KIT,
50 mL, USD $295.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Shuting Cao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The Control diet (A11112201) contained all essential amino acids and nonessential amino acids as specified by Research Diets. Glutamine-supplemented diet contained all amino acids equal to the control diet with the addition of 200 g of glutamine by Ishak Gabra [43] ...
-
No products found
because this supplier's products are not listed.
Juliane F. Tampé, et al.,
bioRxiv - Neuroscience 2024
Quote:
... ethylenediaminetetraacetic acid (EDTA) coated vacutainers (Sarstedt, Germany). All samples were coded not to carry any personal identifier information ...
-
No products found
because this supplier's products are not listed.
Mindy Engevik, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Double side Carbon conductive tape (Cat# 16084-7, Ted Pella Inc) was used to immobilize the wafer on an aluminum SEM sample holder ...
-
No products found
because this supplier's products are not listed.
Rita Gil, Mafalda Valente, Noam Shemesh,
bioRxiv - Neuroscience 2023
Quote:
... The acid was injected using a Nanojet II (Drummond Scientific Company). Animals were anesthetized with isoflurane (anesthesia induced at 5% concentration and maintenance below 3%) ...