-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-hydroxy-1-naphthaldehyde (Ark Pharm); and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Yanwen Fu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.3% Hydroxypropyl Methyl Cellulose (HPMC) (cat# H1335, Spectrum Chemical), pH 5.8).
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
Cat# 5217-59-4,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H5,
1.0 ea, USD $1915.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Embryos are placed in pre-equilibrated (at least 4 h at 37°C, 5% O2, 5% CO2) CSCM-C medium (Irvine Scientific) covered with mineral oil (Irvine Scientific ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Jiangtao Liang, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 5–7-day-old adult females were blood-fed using artificial blood feeders with defibrinated sheep’s blood (HemoStat Laboratories Inc., CA, USA). Egg dishes were placed in cages for oviposition approximately two to three days after blood feeding.
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 400μM 3-isobutyl-1-methylxanthine (IBMX; 2885842; BioGems) for two days then replaced by a supporting medium (SM) ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Blots were blocked in blocking buffer for 1 hour at room temperature and probed overnight at 4°C for PER2 (1:1000 in 5% BSA and TBST; Alpha Diagnostic Intl., Inc., #PER21-A), BMAL1 (1:1000 in 5% BSA and TBST ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... STAM1 (STAM1:DUB = 5:1) or BC-1471 (TargetMol) at indicated concentrations ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Patricia C. Lopes, Robert de Bruijn,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer, Benchmark Scientific), followed by a 5□min rest period ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Yu-Yi Kuo, et al.,
bioRxiv - Immunology 2024
Quote:
... for 5 min and incubated with 1% bovine serum albumin (BSA) (Bioshop Canada Inc.) in PBS for 30 min to block non-specific sites for improving staining ...
-
No products found
because this supplier's products are not listed.
Lauren T. Que, Marie E. Morrow, Cynthia Wolberger,
bioRxiv - Biochemistry 2019
Quote:
... 5 (LifeSensors) FRET-K48 diubiquitin ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Chengyang Li, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the membrane was incubated in 2xTBST buffer with 5% milk prior to primary antibody incubation (1:500 for anti-VAP27; 1:2000 for anti-GFP, Biorbyt orb323045) at room temperature for 3 h ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Emiko Kranz, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured in IMDM supplemented with 7% ultra-low IgG FBS (FB-06, Omega Scientific), Antibiotic-Antimycotic ...
-
No products found
because this supplier's products are not listed.
Ludovic Spaeth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4% for induction then 1-2% for the surgery) and mounted on a stereotaxic frame (Model 68526, RWD Life Science). Body temperature was monitored using a rectal probe and maintained with a heat pad ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...