-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... Id3 (1:1000; 6-1, CalBioreagents), Usp1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... Cells were treated 2h at 37°C with neutrophil elastase (Elastin Products Company), cathepsin G (Biocentrum) ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
John H. Day, et al.,
bioRxiv - Bioengineering 2024
Quote:
... CMs were plated on gelatin for 7 days (Cellular Dynamics) prior to drug treatment and incubated with Dox-containing media for 24 hours prior to fixation and subsequent sample preparation.
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and mice were randomized into treatment groups: (n=7) daily oral gavage of 60 mg kg−1 of eliglustat (AbMole BioScience, M9733) or (n=7 ...
-
No products found
because this supplier's products are not listed.
Susan T. Lubejko, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Internal cannulas were 33G and included 1 mm projection from the end of the guide cannula (Plastics One/Protech International, Inc.). Cannulas were secured to the surface of the skull using light-cured dental epoxy and anchored by one screw ...
-
No products found
because this supplier's products are not listed.
Paul B. Finn, et al.,
bioRxiv - Biochemistry 2020
Quote:
... (R)-2,4-Fmoc-Dab(Boc)-OH (α-amino-GABA turn) was purchased from Peptides International. Monomers were synthesized as previously described [32] ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Maja Gehre, et al.,
bioRxiv - Genetics 2019
Quote:
... Lysis buffer was prepared by diluting one part direct-lysis reagent (301-C, Viagen Biotech) in two parts destilled water (e.g ...
-
No products found
because this supplier's products are not listed.
Alyssa F. Pybus, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were incubated at 4°C overnight with primary antibodies diluted in blocking buffer: GFAP (1:100, Diagnostic Biosystems Mob064), NeuN (1:200 ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Satu Lehti, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Four fractions of 500 µl (fractions 1-4) were collected after the void volume (2.7 ml) with an automated fraction collector (IZON Science, USA), combined and concentrated using ultrafiltration (Amicon Ultra ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Frøydis Sved Skottvoll, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-MAM-d6 and morphine-d3 were purchased from Cerilliant (Austin, TX, USA). Unless otherwise stated ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Teodor E. Yordanov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Sodium Hyaluronate (1-1.8MDa) (Lifecore Biomedical; HA15M-1), Hyaluronidase from Streptomyces hyalurolyticus (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 µg of His-tagged HIV-1 JR-CSF gp120 (Immune Technology) was added to cells for 15 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Aviad Ben-Shmuel, et al.,
bioRxiv - Immunology 2021
Quote:
... Rabbit anti-pSHP-1 (S591) (ECM Biosciences), Rabbit anti-pPLCγ1 (Y783 ...
-
No products found
because this supplier's products are not listed.
Celine Everaert, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and 1 µl reaction buffer (ArcticZymes 66001). Of the resulting volume ...
-
No products found
because this supplier's products are not listed.
Laura Virtanen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... rat monoclonal HSF1 (1:400, 10H8, StressMarq Bioscience Inc.), rabbit monoclonal Lap2α (1:1000 ...