-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
The International Brain Laboratory, et al.,
bioRxiv - Neuroscience 2020
Quote:
Animals (all female and male C57BL6/J mice aged 3-7 months obtained from Jackson Laboratory or Charles River) were co-housed whenever possible ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... 1h DMEM w/o amino acids (Biomol GmbH) + 10% dialyzed FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Brian J. Thomas, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
No products found
because this supplier's products are not listed.
Changliang Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
No products found
because this supplier's products are not listed.
Andrew Shum, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 23mm well fluoro dishes (World Precision Instruments). The intracellular free calcium concentration ([Ca2+]i ...
-
No products found
because this supplier's products are not listed.
Philip J.M. Brouwer, et al.,
bioRxiv - Immunology 2023
Quote:
... Fluoro-octyl maltoside or lauryl maltose neopentyl glycol (Anatrace) were added to protein samples immediately before their applications to grids at final concentrations of 0.02 w/v% and 5 µM ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1H NMR (JEOL, Tokyo, Japan) (400 MHz ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Steven L. Brody, et al.,
bioRxiv - Cell Biology 2024
Quote:
... using phase contrast and Hoffman modulation contrast lenses 20x (Plan Fluoro, Nikon) or 40x (NAMC3 ...
-
No products found
because this supplier's products are not listed.
Haribaskar Ramachandran, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were blocked with 3%BSA diluted in PBS for 1h at RT and then incubated with anti-CD-19-PE antibody (1:50) in 3% BSA-PBS (Miltenyi Biotec) for 1h at RT ...
-
No products found
because this supplier's products are not listed.
Nicholas de Mojana di Cologna, et al.,
bioRxiv - Microbiology 2022
Quote:
... Wells were washed twice with PBS and stained biofilms were resuspended in 7% acetic acid (v/v) and absorbance was read at 595 nm in a Synergy H1 hybrid multimode reader (BioTek).
-
No products found
because this supplier's products are not listed.
Zahraa Alraies, et al.,
bioRxiv - Cell Biology 2023
Quote:
Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
No products found
because this supplier's products are not listed.
Valentina Peona, et al.,
bioRxiv - Genomics 2019
Quote:
... and with short reads using Pilon (two runs; Illumina library; Figure 1h).
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Sabrina Vullo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Oocytes used for VCF experiments were incubated after cRNA injection for 1h in Modified Barth’s Solution (MBS) containing 10 mM 3-maleimidopropionic acid (Bachem) to modify free cysteine residues of proteins natively expressed on the cell membrane ...
-
No products found
because this supplier's products are not listed.
Ruchira Mukherji, et al.,
bioRxiv - Microbiology 2019
Quote:
... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Nicholas Dillon, et al.,
bioRxiv - Microbiology 2020
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)-phosphazene (SynQuest Labs, Inc.) was used as a “lock mass” internal calibrant (m/z 622.028960 ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Min Yao, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and human IgG ELISA kit (Mabtech, #3850-1H-6).
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Pawel Leznicki, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Reactions were incubated for 1h at 22°C in a thermomixer (Eppendorf) with mixing set to 1000 rpm ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3-azido-7-hydroxycoumarin was purchased from Biosynth International Inc ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
7-(Diethylamino)-coumarin-3-carboxylic acid (7-DCCA) has been used as a laser dye, fluorescent...
Cat# S5308, SKU# S5308-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
Hua Lu, Mark A. Lehrman, Julie K. Pfeiffer,
bioRxiv - Microbiology 2019
Quote:
... and oligosaccharides were labeled with 7-amino-1,3-naphthalenedisulfonic acid (81529, AnaSpec) prior to electrophoresis on 20% acrylamide gels ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Hajime Suyama, Veronica Egger, Michael Lukas,
bioRxiv - Neuroscience 2021
Quote:
... using DAPI fluoro mount-G (Southern Biotech, Birmingham, AL, USA).
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
John D. Howard, et al.,
bioRxiv - Bioengineering 2022
Quote:
2’-Fluoro ssRNA was produced by IVT using the Durascribe T7 IVT kit (Epicentre). Reactions consisted of 0.2-1 μg of purified DNA template per 20 μl reaction ...
-
No products found
because this supplier's products are not listed.
Lin Di, et al.,
bioRxiv - Genomics 2022
Quote:
... at 37°C for 1h and purified by Zymo columns ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... and for 1h at RT goat anti-mouse IRDye 680LT (LI-COR) which served as a loading control ...
-
No products found
because this supplier's products are not listed.
Alexis S. Bailey, Margaret T. Fuller,
bioRxiv - Developmental Biology 2023
Quote:
... TSA plus cyanine 3 solution (dilute TSA-Cy3 1:250 in 100mM Boric Acid, pH8.5 containing 0.003% H2O2) (Akoya Biosciences) was added to the tissue sections and incubated for 10 min at RT ...
-
No products found
because this supplier's products are not listed.
Adrien Birot, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Gurueswar Nagarajan, et al.,
bioRxiv - Neuroscience 2024
Quote:
Fluoro-Jade C (Histo-Chem Inc.) stain was used to visualize degenerating neurons according to the manufacturer’s protocol in the target brain regions of ACC ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2-(4-((bis((1-(tert-butyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazol-1-yl)acetic acid (BTTAA, Click Chemistry Tools > 95%), Click-IT™ Fucose Alkyne (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...