-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Antonio Pedro Ricomini Filho, et al.,
bioRxiv - Microbiology 2019
Quote:
... the 18-CSP was synthesized using methoxy-coumarin-acetic-acidyl (MCA) on the N-terminal and Lys-Dinitrophenyl on the C-terminal (Dnp) (MCA-SGSLSTFFRLFNRSFTQA-Dnp; GenScript).
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Eric S. Nealy, et al.,
bioRxiv - Bioengineering 2023
Quote:
7-(Diethylamino)-4- (hydroxymethyl)coumarin (DEAC-OH) was previously synthesized in-house (Method S3) and conjugated to 2-azidoacetic acid (Click Chemistry tools, 1081), 3-azidopropionic acid (Synthonix ...
-
No products found
because this supplier's products are not listed.
Samarpan Maiti, et al.,
bioRxiv - Cell Biology 2023
Quote:
... in a 96-well opaque bottom white plate and 50 µM N-succinyl-Leu-Leu-Val-Tyr-7-amino-4-methyl-coumarin (suc-LLVY-AMC) (Enzo Life Sciences, #BML-P802-0005) was added to each well ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Mathijs P. Verhagen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mice were administered 2-3% dextran sodium sulfate (DSS) in their drinking water for 7 days (#0216011050, MP Biomedicals). DSS-driven inflammation and the corresponding mechanisms underlying the consequent PC dedifferentiation were described in previous studies(11 ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Thomas J. Diprospero, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 7-hydroxycoumarin-d5-sulfate and 7-hydroxycoumarin-13C6-glucuronide were purchased from Toronto Research Chemicals. 4-hydroxymephenytoin-d3 was purchased from MuseChem ...
-
No products found
because this supplier's products are not listed.
Omar A. Saldarriaga, et al.,
bioRxiv - Pathology 2019
Quote:
... 7-color manual IHC kit (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
Elissa Tjahjono, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 7 mM sodium selenite (Alfa Aesar), 10 µM CCCP (Sigma) ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Ryan A.V. Bell, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and recombinant active caspase 3 (0.5 μg; Chemicon) or recombinant active caspase 7 (0.5 μg; Biovision) were incubated for 3 h in cleavage assay buffer (50 mM Hepes ...
-
Cat# HY-125750,
inquire
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
D3 agonist
Sold for research purposes only.
Cat# 1012.0, SKU# 1012-10 mg,
10mg, US $66.00 / EA, EURO, €60 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Tomasz Czerniak, James P Saenz,
bioRxiv - Biochemistry 2021
Quote:
... 7-deaza-GTP (Trilink Biotechnologies, USA) was used ...
-
No products found
because this supplier's products are not listed.
Sharon Khuzwayo, et al.,
bioRxiv - Immunology 2020
Quote:
... The following morning plates were washed with 1x PBS-T before being coated with 3 μg/mL streptavidin-ALP secondary antibody (Mabtech, clone 7-B6-1) and incubated for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
M Bendahmane, et al.,
bioRxiv - Biophysics 2019
Quote:
... synaptotagmin-7 (rabbit polyclonal) are from Synaptic Systems.
-
No products found
because this supplier's products are not listed.
Jimin Lee, et al.,
bioRxiv - Biochemistry 2023
Quote:
... alcyone ACE2 dimer with 7 mM CHAPSO (Anatrace) were applied and blotted twice as previously described88 ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Alireza Saidi-Mehrabad, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 7) ZymoBIOMICS™ DNA Microprep kit (Zymo Research, California, USA) with modifications ...
-
No products found
because this supplier's products are not listed.
Paloma García Casas, et al.,
bioRxiv - Cell Biology 2023
Quote:
COS-7 cells were seeded on µ-Dish 35 mm (Ibidi), co-transfected 24 h later with plasmids encoding ER-Mit RspA-splitFAST and either ER-StayGold ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Joseph Deering, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and pixel size of 7 nm on a Continuum S imaging filter (Gatan). EELS elemental maps for carbon ...
-
No products found
because this supplier's products are not listed.
Tal Iram, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using 7 cycles for chromatin shearing on a Bioruptor Pico sonicator (Diagenode, Cat. No. B01060001). Prior to sonication ...
-
No products found
because this supplier's products are not listed.
Samantha R. Weaver, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... PTH(7-34) (Bachem), or vehicle (0.1% BSA in PBS ...
-
7-(Diethylamino)-coumarin-3-carboxylic acid (7-DCCA) has been used as a laser dye, fluorescent...
Cat# S5308, SKU# S5308-25mg,
25mg, $97.00
Ask
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HUVECs were serum starved in M199 media with 0.5% FBS for 3 h followed by a 7 h treatment with 1 μM group I PAK inhibitor FRAX1036 (Selleck Chemicals).
-
No products found
because this supplier's products are not listed.
Xinquan Liu, Debadyuti Ghosh,
bioRxiv - Bioengineering 2019
Quote:
... and Cyanine 7 (Cy7, Lumiprobe) was conjugated to monomeric BSA according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Shirsendu Ghosh, et al.,
bioRxiv - Biophysics 2020
Quote:
7) Glass bottom culture dish (MatTek, 35 mm petri dish ...
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Sofia A. Quinodoz, et al.,
bioRxiv - Genomics 2020
Quote:
AEBSF (Gold Biotechnology CAS#30827-99-7) is added to the Proteinase K (NEB Proteinase K #P8107S ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
Heleen Kraan, Geert-Jan Willems, Peter C. Soema,
bioRxiv - Immunology 2022
Quote:
... wells were coated with a mixture of 7 μg/mL purified goat-anti-mouse kappa and 7 μg/mL purified goat-anti-mouse lambda (Southern Biotech). As a negative control ...
-
No products found
because this supplier's products are not listed.
Chikako Okubo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse monoclonal anti-p53 (DO-7) (1:200, Novus Biologicals), goat polyclonal anti-p53 (1:100 ...
-
No products found
because this supplier's products are not listed.
Mindy Engevik, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Double side Carbon conductive tape (Cat# 16084-7, Ted Pella Inc) was used to immobilize the wafer on an aluminum SEM sample holder ...
-
No products found
because this supplier's products are not listed.
Matvei Khoroshkin, et al.,
bioRxiv - Systems Biology 2023
Quote:
... and end labeled with 3’-Azido-3’-dUTP and IRDye® 800CW DBCO Infrared Dye (LI-COR) on beads ...
-
No products found
because this supplier's products are not listed.
Joshua M. Boyte, et al.,
bioRxiv - Plant Biology 2023
Quote:
... pairs of 7 d old seedlings were transferred to 96-well LUMITRAC™ 200 plates (Greiner) containing 250 µl ½ MS (0.8% agar ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...