-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
ELISA, ICC/IF
Cat# CDC-36,
0.1 mg, Inquire
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Omolade Otun, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 0.001% CHS (w/v) and 0.4 mg/ml Flag peptide (Covalab). The eluate was concentrated using a 50kDa molecular weight cutoff (MWCO ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Mahmoud M. Elguindy, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Chromosome enumeration probes for chromosome 7 (CHR7-10-GR) and chromosome 20 (CHR20-10-RE) were purchased from Empire Genomics. Cells were trypsinized ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Andreas I. Andreou, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 2.5 μM DEX (Acros) or 5 μM β-estradiol (LKT laboratories) were added.
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Carbonyl Fe powder (5-9 μm) was purchased from STREM Chemicals (Newburyport, MA, USA). Fe2O3 nanopowders (50-200 nm ...
-
No products found
because this supplier's products are not listed.
Thibault Courtellemont, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.5 OD600 units were transferred into 5 mL of SC-arginine/-lysine (Sunrise Science Products) supplemented with 0.43 mM arginine and lysine ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
7-Cl-O-Nec1 is a small molecule which can act as a RIPK1 inhibitor and Necroptosis inhibitor. It...
Cat# abx283039-5MG,
5 mg USD $152.25
Ask
Daniel C. Levine, et al.,
bioRxiv - Neuroscience 2024
Quote:
... hypothalamus from PER2-TgWT mice that were fasted for 16 hours or given ad libitum access to HFD for 1 week was excised at ZT16 and extracted with ∼5 volumes of strong RIPA buffer containing kinase and phosphatase inhibitors (Abbexa abx090624), sonicated in a water bath 3 x 30sec on high ...
-
No products found
because this supplier's products are not listed.
Lisanne de Vor, et al.,
bioRxiv - Microbiology 2021
Quote:
... antibodies were buffer exchanged into conjugation buffer and incubated at 37°C for 1.5 h with a 5-fold molar excess of bifunctional CHXA” (Macrocyclics, prepared less than 24 h before use). The mAb-CHXA” conjugate was then exchanged into 0.15 M ammonium acetate buffer to remove unbound CHXA” and subsequently incubated with approximately 150 kBq 111In (purchased as [111In]InCl3 from CuriumPharma ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Prabhu S. Arunachalam, et al.,
bioRxiv - Immunology 2021
Quote:
... Alum (Alhydrogel 2%) was purchased from Croda Healthcare (Batch #0001610348) ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Michael B. Geary, et al.,
bioRxiv - Pathology 2022
Quote:
... and the skin was closed with either 7 mm stainless steel wound clips (CellPoint Scientific Inc., Gaithersburg, MD) or a series of interrupted 5-0 nylon sutures ...
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Chao Zhai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Caps with O-rings (BIOLOGIX, lot #81-0004) were screwed into the polypropylene tubes ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Maxence Le Vasseur, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Gel slices (2mm x 7mm) were excised along the entire lane using disposable gel cutter grids (The Gel Company, San Francisco, CA, cat# MEE2-7-25). Ten gel slices ranging from ∼600-900kDa were collected in 100µl of 50mM ammonium bicarbonate (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Mohd Sariq, Omkar, Geetanjali Mishra,
bioRxiv - Zoology 2023
Quote:
... Adults of both species were paired and placed in beakers separately under laboratory conditions (27 ± 2°C temperature; 65 ± 5% relative humidity; 14L:10D photoperiod in Biochemical Oxygen Demand Incubators; Yorco Super Deluxe, YSI-440 New Delhi, India) and were provided with ad libitum supply of aphids ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Hisayoshi Kubota, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were blocked with 5% fetal bovine serum (Nichirei Bioscience Inc., Tokyo, Japan) in PBST for 2 h and then incubated with primary antibodies in PBST at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Rishi R. Agrawal, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Oil Red O 0.5% solution in propylene glycol (Poly Scientific R&D Corp. s1848) was applied for 1h ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Kishor Dnyaneshwar Ingole, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The membrane was blocked with 5% non-fat skim milk and western blots performed with indicated primary antibodies [anti-SNC1 (Abiocode), anti-PR1 or anti-PR2 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Lale Ozcan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Plasma insulin levels were measured in mice that were fasted for 5 h using an ultra-sensitive mouse insulin ELISA kit (Crystal Chem). The Columbia University IACUC provided ethical approval for these studies ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
T Feige, et al.,
bioRxiv - Cell Biology 2023
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2, Emfret Analytics) or GPVI (JQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Arina V. Drobysheva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
For phi14:2 RNAP transcription assay genomic DNA of phi14:2 was purified using the Phage DNA Isolation Kit (Norgen Biotek Corp) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adrian Kendal, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 7 % w/v polymer solution of PDO (Riverpoint Medical, Portland, Oregon , USA) in 1,1,1,3,3,3-Hexafluoro- 2-propanol (HFIP, Halocarbon Product Corporation ...
-
No products found
because this supplier's products are not listed.
Blasi Maria, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were then incubated with 2 μg/ml biotinylated rabbit anti-human IFN-γ (U-CyTech biosciences, Utrecht, The Netherlands) for 2 hours at room temperature ...