-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Victoria A. Bonnell, et al.,
bioRxiv - Genomics 2023
Quote:
... Sonicate the chromatin until sufficiently sheared (130µL, 5% duty cycle, 75W peak incident power, 200 cycles per burst, 7°C, for 5 minutes using Covaris Focus-Ultrasonicator M220). The immunoprecipitation step included ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... we measured commercially available Quantum™ FITC-5 MESF (7 μm, Catalog No. 555, lot 14609, Bangs Laboratories) and AccuCheck ERF Reference Particles Kit (3 μm ...
-
No products found
because this supplier's products are not listed.
Drew E. Glaser, et al.,
bioRxiv - Bioengineering 2020
Quote:
... MCF-7 (Cell Biolabs) breast cancer cells (estrogen and progesterone receptor positive ...
-
No products found
because this supplier's products are not listed.
Antonius A de Waard, et al.,
bioRxiv - Immunology 2020
Quote:
... CD8+ T cell clones recognizing peptides derived from the endogenously expressed proteins USP11 and SSR1(7, 8) were expanded using a standard feeder mix in IMDM supplemented with 5% human serum (Sanquin) and 5% FCS(9).
-
No products found
because this supplier's products are not listed.
Eirik S. Nilssen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Iontophoretic injections used a current source driving alternating 6 seconds on/off current (5-15 minutes; 7 µA or 6 µA; Stoelting Midgard).
-
No products found
because this supplier's products are not listed.
Akshatha N. Srinivas, et al.,
bioRxiv - Physiology 2023
Quote:
... 7’-dichlorofluorescein diacetate (DCFH-DA) (BioVision) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pablo Sanchez Bosch, et al.,
bioRxiv - Immunology 2019
Quote:
... was injected into the thorax or abdomen of anesthetized females aged 5-7 days using a Nanoject II injector (Drummond Scientific Inc.) fitted with a pulled glass capillary ...
-
No products found
because this supplier's products are not listed.
Dharendra Thapa, et al.,
bioRxiv - Physiology 2022
Quote:
Male WT and GCN5L1 KO animals aged 5-7 months were fed either a standard low fat diet (LFD; Research Diets D12450B), or a high fat diet (HFD ...
-
No products found
because this supplier's products are not listed.
Jiangtao Liang, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 5–7-day-old adult females were blood-fed using artificial blood feeders with defibrinated sheep’s blood (HemoStat Laboratories Inc., CA, USA). Egg dishes were placed in cages for oviposition approximately two to three days after blood feeding.
-
No products found
because this supplier's products are not listed.
Connor D. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and QCapture Pro 7 software (Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Tanay Ghosh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in QuantStudio 7 Flex (Applied Biosystems, ABI) machine ...
-
No products found
because this supplier's products are not listed.
Ziyu Zhao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brd4 (Bethyl Laboratories, A301-985A, lot#7), and H3K9me3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Christiane Geithe, et al.,
bioRxiv - Biochemistry 2021
Quote:
We used hybriwell chambers (16 wells, 7 mm x 7 mm x 0.05 mm; RD477991, Grace Bio-Labs, Oregon, USA) that were customized according to our needs ...
-
No products found
because this supplier's products are not listed.
M Bendahmane, et al.,
bioRxiv - Biophysics 2019
Quote:
... synaptotagmin-7 (rabbit polyclonal) are from Synaptic Systems.
-
No products found
because this supplier's products are not listed.
Heleen Kraan, Geert-Jan Willems, Peter C. Soema,
bioRxiv - Immunology 2022
Quote:
... wells were coated with a mixture of 7 μg/mL purified goat-anti-mouse kappa and 7 μg/mL purified goat-anti-mouse lambda (Southern Biotech). As a negative control ...
-
No products found
because this supplier's products are not listed.
Nicholas R Saichek, et al.,
bioRxiv - Microbiology 2021
Quote:
Glucose (CAS 50-99-7) was from Amresco (Solon, OH). 13C-glutamine (C5-99%) ...
-
No products found
because this supplier's products are not listed.
Chikako Okubo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse monoclonal anti-p53 (DO-7) (1:200, Novus Biologicals), goat polyclonal anti-p53 (1:100 ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Regla M. Medina-Gali, et al.,
bioRxiv - Biochemistry 2023
Quote:
... d16-BPA CAS number: 80-05-7 (Cambridge Isotope Laboratories, Massachusetts, USA), d14-BPA CAS number ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Inês Caldeira Brás, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with 100mL culture medium for 7 days containing DMEM (PAN Biotech, Aidenbach, Germany) supplemented with 10% FBS (Anprotec ...
-
No products found
because this supplier's products are not listed.
Tim J. Viney, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a 7 stranded PerFluoroAlkoxy-coated steel wire (0.002 inch thickness, A-M Systems) was stereotaxically inserted into CA1d to target stratum pyramidale (−2.30 mm antero-posterior (AP ...
-
No products found
because this supplier's products are not listed.
Joseph Deering, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and pixel size of 7 nm on a Continuum S imaging filter (Gatan). EELS elemental maps for carbon ...
-
No products found
because this supplier's products are not listed.
Erica A. Birkholz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-7 µl of cells were deposited on R2/1 Cu 200 grids (Quantifoil) that had been glow-discharged for 1 min at 0.19 mbar and 20 mA in a PELCO easiGlow device shortly before use ...
-
No products found
because this supplier's products are not listed.
Francois Chesnais, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Cells are kept in static culture for 7 days and maintained in EGMV2 (PromoCell) changed every other day from the top of the device ...
-
No products found
because this supplier's products are not listed.
Khadija Hassan, et al.,
bioRxiv - Biochemistry 2022
Quote:
... VP Nucleodur 100-5C 18 ec column (250 ×40 mm, 7 μm: Macherey-Nagel) used as stationary phase ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Gidon Levakov, et al.,
bioRxiv - Neuroscience 2021
Quote:
... DS1 is composed of 542 subjects (305 females, 192 males) aged 7-84 recruited from Rockland County ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Eleanor Minogue, et al.,
bioRxiv - Immunology 2022
Quote:
... The product was detected by using an anti-5-Hydroxymethylcytosine antibody (5 nM, Active Motif), Eu-Protein A (5 nM ...
-
No products found
because this supplier's products are not listed.
Shuntaro Morikawa, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Fluorescence for cell viability and luminescence for caspase-3/7 activity was measured using Infinite M1000 plate reader (Tecan). Caspase-3/7 activity was normalized to cell viability according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Amber F. Buhagiar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MCF10A cells were treated with 1 mM 5-ethynyl uridine (5-EU; Click Chemistry Tools 1261) for 1 h to label nascent RNA as in (Bryant et al ...
-
No products found
because this supplier's products are not listed.
Matthias Fellner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Caspase 3-like activity was measured fluorometrically by the addition of 50 µM acetyl-Asp-Glu-Val-Asp-7-amino-4-methylcoumarin (Ac-DEVD-AMC) at 37 °C in 96-well plates using a ClarioSTAR microplate reader (BMG LABTECH). The production of AMC (λEM = 390 nm ...
-
No products found
because this supplier's products are not listed.
Marco Leibinger, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 7-dihydroxytryptamine (DHT, Biomol). DHT was dissolved in 0.5 μl of 0.2 % ascorbic acid in saline ...
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Alexandra C McHale-Matthews, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the separated at 1-week infants had the mother removed from the cage and the infant was left in the single cage to learn how to bottle feed for a 5-7 day period (ad libitum Similac with Iron baby formula; Abbott Laboratories, Columbus OH). A soft ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Zezhong Zheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
Gene editing of COS-7 cells were performed by electroporation of COS-7 cells with Super PiggyBac plasmid (PB210PA-1, System Biosciences) and one of the 5 plasmids of pBv1-EF-6X ...
-
No products found
because this supplier's products are not listed.
Mason A. McCool, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Swollen cells were dounced using a 7 mL dounce (Wheaton, 3575420) for 20 strokes ...
-
No products found
because this supplier's products are not listed.
Valeria Lulla, Andrew E. Firth,
bioRxiv - Microbiology 2019
Quote:
... aminoguanidine (Cambridge Bioscience, 5 mM) and sodium L-ascorbate (Sigma ...
-
No products found
because this supplier's products are not listed.
Haleigh N. Mulholland, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a 5 MΩ electrode (FHC) was driven approximately 7 mm down perpendicularly into the brain using a micromanipulator ...
-
No products found
because this supplier's products are not listed.
Daniel Egert, et al.,
bioRxiv - Bioengineering 2020
Quote:
... blocked and incubated for 7-10 days at room temperature with both primary antibodies Rb ∝ mOR (ImmunoStar 24216) and Ms ∝ NeuN (Millipore MAB377) ...
-
No products found
because this supplier's products are not listed.
Michael J. Hoy, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 M Sodium Chloride (Teknova #S0251), TCEP (Soltec Ventures Inc #M115) ...
-
No products found
because this supplier's products are not listed.
Hwan-Ching Tai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and a 5-µm filter (Pall, 4662). The filtrate was spun at 1,000 xg for 10 mins at 4 °C ...
-
No products found
because this supplier's products are not listed.
Wudi Wei, et al.,
bioRxiv - Microbiology 2022
Quote:
... the PBMCs were cultured for 7 days in presence of 25ng/mL recombinant human macrophage colony-stimulating factor (rh-MCSF, Sino Biological, China). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2.
-
No products found
because this supplier's products are not listed.
Stephan Kamrad, et al.,
bioRxiv - Genetics 2019
Quote:
... column (New Objective, PF360-75-10-N-5) packed in house with 1.9 um C18 beads (Dr ...