1 - 50 of 621
suppliers found for
7 Chloroquinoline 2 3 dicarboxylic acid
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 892874-52-1, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... and 100 μM l-trans-pyrrolidine-2,4-dicarboxylic acid (PDC, Sigma- Aldrich) for 5 days ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions. -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... 2,4-Pyridine Dicarboxylic Acid (2,4-PCA) is purchased from Acros Organics (New Jersey, Catalog number 101860010). JIB-04 is purchased from Sigma-Aldrich (St ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 6R)-4-Amino-2-oxabicyclo [3.1.0] hexane-4,6-dicarboxylic acid disodium salt (LY379268, 100 µM, Tocris); calmidazolium chloride (CMZ ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Pathology 2022Quote: ... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 15-octadecatrienoic acid (C18:3 ω-3, α-linolenic acid; Cayman Chemical, #90210), all cis-6 ... -
Merck
No products found because this supplier's products are not listed.Cited in Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Antonie van Leeuwenhoek doi: 10.1007/s10482-018-1014-zQuote: ... or salycyclic acid (Alfa Aesar, cas: 69-72-7). The endophytes were typically incubated for 5 days at 30 °C ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in E3 ubiquitin ligase MARCHF5 controls BAK apoptotic activity independently of BH3-only proteinsbioRxiv - Cell Biology 2022Quote: ... BCL-2 (Clone#7/BCL-2, BD Bioscience), MCL-1 (Cat#600-401-394 ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017Quote: ... 3 mM 3-mercaptopicolinic acid (3-MPA, Santa Cruz) was used to inhibit endogenous glucose production ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.Cited in ER shaping proteins regulate mitochondrial fission, outer membrane permeabilization and apoptosisbioRxiv - Cell Biology 2018Quote: ... caspase-3 and caspase-7 from Cell Signaling Technologies (Danvers, MA, USA) and GAPDH from SantaCruz Biotechnologies (Santa Cruz ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Epidemiology 2020, published in Pathogens doi: 10.3390/pathogens9030176Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 5-Nitro-2-(3-phenylpropylamino)benzoic acid (NPPB, 0593) was sourced from Calbiochem. -
BioLegend
No products found because this supplier's products are not listed.Cited in Lipid-mediated insertion of Toll-like receptor (TLR) ligands for facile immune cell engineeringbioRxiv - Immunology 2019, published in Frontiers in Immunology doi: 10.3389/fimmu.2020.00560Quote: ... and IL-7 (2 ng/mL, Biolegend) at 37°C for 2 days ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB). -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Molecular Pharmacology doi: 10.1124/mol.119.117069Quote: ... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ... -
Addgene
No products found because this supplier's products are not listed.Cited in Intermitochondrial signaling regulates the uniform distribution of stationary mitochondria in axonsbioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... IL-2 and IL-7 were purchased from Peprotech, reconstituted in sterile water ... -
Jena Bioscience
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in eLife doi: 10.7554/elife.37243Quote: ... or 3-azido-7-hydroxycoumarin (Jena Biosciences, Jena, Germany). For M ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... PBMCs from healthy individuals were isolated and expanded in vitro for 7 days in the presence of 50 ng/ml of OKT-3 (Miltenyi) and 600 IU/ml IL-2 (R&D Systems) in AIM-V (Gibco ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... Proteins were loaded into 7 cm IPG Strips 3-10 (GE Healthcare) by overnight passive rehydration ... -
Agilent
No products found because this supplier's products are not listed.Cited in Reconstructing cell interactions and state trajectories in pancreatic cancer stromal tumoroidsbioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0220586Quote: ... Solution B comprised 30 μl of solution A supplemented with 2 μl of a solution prepared by dissolving 120 mg of phenyl boronic acid in 3 ml dimethyl sulfoxide (VWR International catalog # BDH1115-1LP) and adding this to 3 ml sterile inoculum water (Beckman Coulter ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Scientific Reports doi: 10.1038/s41598-020-62089-6Quote: ... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ... -
PerkinElmer
No products found because this supplier's products are not listed.Cited in Stem cell delivery to kidney via minimally invasive ultrasound-guided renal artery injection in micebioRxiv - Cell Biology 2019Quote: ... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Genetics 2021Quote: Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... fluorescence was measured on a FlexStation 3 Multi-Mode Microplate Reader using SoftMax Pro 7 software (Molecular Devices) in kinetic mode in response to additions of a range of concentrations of PTH ... -
Sartorius
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Nature Communications doi: 10.1038/s41467-020-18020-8Quote: ... Caspase-3/7 green apoptosis assay reagent (Sartorius #4440) was added to the cells and transferred to Incucyte® ZOOM 2FLR system and analyzed using 2016 an integrated software. -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Pathology 2021Quote: ... or ethyl-3-4-dihydroxybenzoic acid (DHB, TCI America, Portland) and incubated with collagen (10 µg/ml ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ... -
World Precision Instruments
No products found because this supplier's products are not listed.Cited in Signal requirement for cortical potential of transplantable human neuroepithelial stem cellsbioRxiv - Developmental Biology 2021Quote: ... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
Gold Biotechnology
No products found because this supplier's products are not listed.Cited in An interaction map of transcription factors controlling gynoecium development in ArabidopsisbioRxiv - Plant Biology 2018Quote: ... the gynoecia were collected and incubated 7 h at 37°C with a 5-bromo-4-chloro-3-indolyl-b-glucuronic acid solution (Gold Biotechnology, St Louis ... -
Sutter Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
Cambridge Isotope Labs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: 3 μL of human plasma were spiked with 3 μL amino acid isotope labelled internal standards (Cambridge Isotope Laboratories, #MSK-A2-1.2) and extracted with 250 μL –20 °C methanol for 10 min and centrifuged at 4°C for 10 min at 15 000 g ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...