-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Patricia A Blundell, et al.,
bioRxiv - Immunology 2019
Quote:
Native influenza B Hong-Kong 5/72 was obtained from Meridian Life Sciences. To determine the optimal virus-to-erythrocyte ratio ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Ivana Jaric, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and then 20 strokes of pestle B (tight pestle) in a glass douncer (7 ml Dounce tissue grinder set, KIMBLE, DWK Life Sciences). The lysate was transferred to an ultracentrifuge tube ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Anna Stier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or Aurora B (SignalChem) kinases ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Marie F.A. Cutiongco, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
No products found
because this supplier's products are not listed.
Li-Ying Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cells were grown for 5 days in iCell Neural Base Medium 1+ iCell Neural Supplement B (M1010, M1029, FUJIFILM Cellular Dynamics). Then the cells were treated with 6-OHDA (50 µM ...
-
No products found
because this supplier's products are not listed.
Brian J. Sanderson, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... All seeds were sown on autoclaved Gamborg’s B-5 Basal Salts (without sucrose) and Phytoblend agar (Caisson Laboratories, Inc., Smithfield, Utah, USA) and poured into sterilized petri dishes ...
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... supplemented with hygromycin B (PhytoTechnology Laboratories) at a final concentration of 50 µg/ml ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
All viral vectors
Cat# KC30600,
ViroMag 100µL + ViroMag RL 100µL + AdenoMag 100µL + Magnetic Plate MF10000, USD $715.00/KIT
Ask
Zeyang Shen, et al.,
bioRxiv - Genomics 2021
Quote:
... 2.5 μl/ml lentiblast B (OZ Biosciences) and 8 μg/ml polybrene (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Isabella Vlisidou, et al.,
bioRxiv - Microbiology 2019
Quote:
... were added to one BioPORTER tube (Genlantis) and resuspended in 920 μl of DMEM ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Yu Zhang, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The pairwise correlations between transcriptomes were calculated by gene expression levels (as estimated by TPM) of 3987 one-to-one orthologs across the 21 species (including the public dataset, Medicago) (Figure S7) ...
-
No products found
because this supplier's products are not listed.
Teridah Ernala Ginting, et al.,
bioRxiv - Immunology 2023
Quote:
... Veriplex® 9-plex human cytokine ELISA kit (PBL Assay Science, Piscataway, NJ, USA) was used according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Pei Ying Ng, et al.,
bioRxiv - Cell Biology 2022
Quote:
Rabbit polyclonal anti-Cathepsin B (Atlas Antibodies, Cat#: HPA018156)
-
No products found
because this supplier's products are not listed.
Sithurandi Ubeysinghe, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 25 µL aliquot was pipetted from the cell suspension into a 4×5 mm glass cylinder (7030304; Bioptechs) fixed on a glass bottom dish with high-temperature silicon grease ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Dhananjay M. Nawandar, et al.,
bioRxiv - Microbiology 2022
Quote:
... One or two drops of 0.5% proparacaine (McKesson Corp.) were applied to the eye ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult WT and MSxc rats (N=10 and 9, respectively) underwent autoshaping in operant chambers (Campden Instruments) equipped with touch-sensitive display screens (Horner et al. ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Nuria Tubau-Juni, et al.,
bioRxiv - Immunology 2019
Quote:
... plates supplemented with 7% of Horse laked blood (Lampire Biological Laboratories, Pipersville, PA) and H ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Shanshan Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
Brains were submerged in Golgi-Cox solution A + B (FD Neurotechnologies Inc., Ellicot City, Maryland) for 8 days followed by solution C for 4 days at room temperature ...
-
No products found
because this supplier's products are not listed.
Sebastian Jusuf, et al.,
bioRxiv - Microbiology 2020
Quote:
... GBS (ATCC 12386) was grown in New Granada Media/Strep B Carrot Broth (Z40, Hardy Diagnostics) at 37°C for 48 to 72 hours until the broth turned a rich orange-red color ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Tise Suzuki, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... One thousand PDX4 cells were seeded in triplicates in flat-bottomed 96-well plates (229195; CELLTREAT Scientific Products) and allowed to adhere for 24 hours prior to the addition of cisplatin or Olaparib (AZD2281 ...
-
No products found
because this supplier's products are not listed.
Laura M. Chambers, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... cells were plated at 65 % confluence in a 100 mm dish and cultured in 9 mL DMEM supplemented with heat inactivated 10% FBS (Atlas Biologicals Cat # F-0500-D, Lot F31E18D1)[15] ...