-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Zixuan Liu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
A Cell Counting Kit-8 (CCK-8) assay (M4839, AbMole) was used to analyze cell viability ...
-
No products found
because this supplier's products are not listed.
Jérémie Prévost, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-Luciferin free acid (Prolume). The neutralization half-maximal inhibitory concentration (IC50 ...
-
No products found
because this supplier's products are not listed.
Soohyun Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... The peptide was biotinylated on the N terminus via coupling with biotin-polyethylene glycol (PEG)4-propionic acid (ChemPep). Dry peptide resin was cleaved using 94% trifluoroacetic acid ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Joanna M. Reinhold, Ryan Shaw, Chloé Lahondère,
bioRxiv - Zoology 2020
Quote:
Mosquitoes were released into a covered 8 × 8 × 8” metal collapsible cage (BioQuip Products, Rancho Dominguez, CA) and allowed to feed on adult bovine blood (Lampire Biological Laboratories, Pipersville, PA). Blood was placed into a water bath-heated glass blood feeder (D.E ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
No products found
because this supplier's products are not listed.
Ahmed S Abdelfattah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ~1×105 cells per well in 100 μL of a 4:1 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... the human KDM4C enzyme (8 nM, BPS Bioscience) was incubated with the substrate of H3(1-21 ...
-
No products found
because this supplier's products are not listed.
Tess Cherlin, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 8 x 25 Capillary Cartridge (Protein Simple #SM-W004). Primary antibodies ...
-
No products found
because this supplier's products are not listed.
Ge Song, et al.,
bioRxiv - Immunology 2020
Quote:
... YP_003767.1) and HCoV-229E (1173 amino acids; GenBank: NP_073551.1) were cloned into the mammalian expression vector phCMV3 (Genlantis, USA) using PstI and BamH restriction sites ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... raised against CAKSKAKPPKGAHVEV = Cys + amino acids 1183-1197 of the human protein) and human anti-CREST (1:1,000; hct-0100, ImmunoVision). Secondary antibodies (all 1:500) ...
-
No products found
because this supplier's products are not listed.
Shikai Hu, et al.,
bioRxiv - Pathology 2021
Quote:
Total hepatic bile acids were measured using the Mouse Total Bile Acids Assay Kit from Crystal Chem (Downers Grove, IL), as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Coralie Zangarelli, et al.,
bioRxiv - Genomics 2022
Quote:
A peptide corresponding to PgmL1 amino acid sequence 1 to 266 and carrying a C-terminal His tag was used for guinea pig immunization (Proteogenix). Sera were purified by antigen affinity purification to obtain highly specific α−PgmL1-GP antibodies (0.8 mg/mL) ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Sara Abdulkader, John Gigg,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
Training took place in 8 operant chambers (Campden instruments Ltd, UK), each placed inside a ventilated and sound-attenuating box ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL reaction was performed with 4 ug/mL recombinant human ULK2 protein (1-478, SignalChem #U02-11G) and 80 ug/mL MBP in the presence of 25 uM ATP ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Periodic Acid-Schiff (PAS) Diastase Stain Kit (for polysaccharides staining) (ScyTek Laboratories), and Amyloid Stain Kit (Congo Red ...
-
No products found
because this supplier's products are not listed.
Emiko Kranz, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured in IMDM supplemented with 7% ultra-low IgG FBS (FB-06, Omega Scientific), Antibiotic-Antimycotic ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
C Colomer-Winter, et al.,
bioRxiv - Microbiology 2019
Quote:
... wells were coated overnight at 4°C with 100 µg ml-1 human fibrinogen free of plasminogen and von Willebrand Factor (Enzyme Research Laboratory). The next day ...
-
No products found
because this supplier's products are not listed.
Shikha Yadav, et al.,
bioRxiv - Cell Biology 2023
Quote:
Day 7 BMDMs were washed twice to remove traces of FCS and then incubated in starvation medium from Cell applications Inc ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Matthew B. Lohse, et al.,
bioRxiv - Genetics 2020
Quote:
... samples were acidified to pH 2 with 5 µL of 20% formic acid (JT Baker 0128-01) before desalting with C18 Desalting Tips (Rainin 17014047). Samples were eluted in 40µL of a 50:50 acetonitrile (Sigma 34851 ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Megan Mey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TrkB ser478 (1:1,000; Biosensis, CA), LHCGR (1:500 ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...