-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... Cells were treated 2h at 37°C with neutrophil elastase (Elastin Products Company), cathepsin G (Biocentrum) ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Lone Buchwaldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 × 7 cm pieces of stretched Parafilm (Bemis Company Inc, Oshkosh, WI, USA) with the mycelium facing up ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and mice were randomized into treatment groups: (n=7) daily oral gavage of 60 mg kg−1 of eliglustat (AbMole BioScience, M9733) or (n=7 ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Expanded gels were transferred into 50×7 mm glass bottom dishes (WillCo Wells) for imaging ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 4% chlorhexidine (McKesson Corporation) or 2% acetic acid (Akorn Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ruicai Long, et al.,
bioRxiv - Plant Biology 2021
Quote:
A Chinese native alfalfa cultivar Zhongmu-4 (Medicago sativa L. cv. Zhongmu-4), one of the most planted alfalfa in North China for its high yield ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Raquel Garza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4% buffered formalin (Histo-Lab Products AB ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Ameya P. Jalihal, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and imaged on a Bioptechs temperature control module (Bioptechs, 0420-4). High-throughput IF was performed on the same microscope using a 60x 0.9 NA air objective ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Teodor E. Yordanov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Sodium Hyaluronate (1-1.8MDa) (Lifecore Biomedical; HA15M-1), Hyaluronidase from Streptomyces hyalurolyticus (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... followed by an overnight incubation at +4°C with anti-OVA257-264 Dextramer PE conjugate (SIINFEKL, IMMUDEX, Virum Denmark) diluted 1:30 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 µg of His-tagged HIV-1 JR-CSF gp120 (Immune Technology) was added to cells for 15 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Tiphaine Péresse, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 1% antibiotics (Zell Shield, Minerva Biolabs) and were incubated at 37°C in a 5% CO2 humidified atmosphere ...
-
No products found
because this supplier's products are not listed.
Aviad Ben-Shmuel, et al.,
bioRxiv - Immunology 2021
Quote:
... Rabbit anti-pSHP-1 (S591) (ECM Biosciences), Rabbit anti-pPLCγ1 (Y783 ...
-
No products found
because this supplier's products are not listed.
Celine Everaert, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and 1 µl reaction buffer (ArcticZymes 66001). Of the resulting volume ...
-
No products found
because this supplier's products are not listed.
Laura Virtanen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... rat monoclonal HSF1 (1:400, 10H8, StressMarq Bioscience Inc.), rabbit monoclonal Lap2α (1:1000 ...