-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Yu Ning, et al.,
bioRxiv - Microbiology 2020
Quote:
... Itraconazole (ITZ) and amphotericin B (Amp B) were purchased from LKT Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 2x gentamicin/amphotericin B (CELLnTEC, Bern, Switzerland) over night at 4 °C ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Ryoji Amamoto, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... chicken B-galactosidase (1:3000, Aves Labs, cat. #BGL1010), goat B-galactosidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Elisa Matas-Rico, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Granzyme B-PE (1:200, clone GB11, Sanquin Amsterdam). To detect cytokine production ...
-
No products found
because this supplier's products are not listed.
Sarah A. Ware, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Pools B-E were purchased (BioIVT, Hicksville, NY, USA). Each lot was aliquoted and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 2: 2-Amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid (LysAlk, AstaTech); 3 ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Chiho Watanabe, et al.,
bioRxiv - Biophysics 2022
Quote:
... and rhodamine-B-labeled PEG with a molar mass of 5 kg/mol (RB-PEG5k; Nanocs, MA, USA). Additionally ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Shikha Yadav, et al.,
bioRxiv - Cell Biology 2023
Quote:
Day 7 BMDMs were washed twice to remove traces of FCS and then incubated in starvation medium from Cell applications Inc ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... Rabbit Polink-2 HRP (GBI Labs; Cat ...
-
No products found
because this supplier's products are not listed.
Gong-Her Wu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Quantifoi®l R 2/2 Micromachined Holey Carbon grid: 200 mesh gold (SPI supplies Cat#:4420G-XA) grids were prepared for cell plating by sterilizing using forceps to carefully submerge them in 100% ethanol (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... A SARS-CoV-2 neutralization antibody (EpiGentek), which targets the spike RBD ...
-
No products found
because this supplier's products are not listed.
Lihong Chen, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 2 mg monoclonal antibody to collagen II (Chondrex) in 50 ul of PBS was administered by intraperitoneal injection ...
-
No products found
because this supplier's products are not listed.
Alexander von Appen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat α-Tubulin (YL1/2; Accurate Chemical & Scientific), SUN1 (ab124770 ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Yang Tian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The proteins were labeled with 2 μL of 0.5% CD2O and 10 μL of 10 mM Borane Pyridine Complex (BPC) (J&K Scientific Ltd., Beijing, China, cat. no. 121499) for 30 min ...
-
No products found
because this supplier's products are not listed.
Dieter Waschbüsch, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The gel was then stained for 1h using Instant Blue Coomassie (Expedeon). Protein concentrations were adjusted using the upper protein band ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
Cat# 357263-48-0,
Inquire
Ask
Micah Y. Belew, et al.,
bioRxiv - Neuroscience 2023
Quote:
Nicotinamide Riboside (NR) (BOC sciences cas no 1341-23-7) was supplemented as described in (35) ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Mariana Galvão Ferrarini, et al.,
bioRxiv - Immunology 2022
Quote:
... and a Coleoptericin B (ColB) primary polyclonal anti-serum (Proteogenix, Schiltigheim-France) at 1:300 dilution in 0.1% BSA were used ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Insulin secretion was measured with a human insulin ELISA (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
Native Toxin
Cat# CDB-TDL-100,
100µg USD $1441.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... SARS-CoV-2 S2 (The Native Antigen Company, REC31807-500), S1 (The Native Antigen Company ...