-
No products found
because this supplier's products are not listed.
Carmen Bekeova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 μm C-18 column (Phenomenex) kept at 35°C ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Shayne N Hassler, et al.,
bioRxiv - Neuroscience 2020
Quote:
... followed by 25 minutes of incubation at 37□C in 3 mg/ml collagenase type 2 (LS004176; Worthington) and 2 mg/ml Dispase II (04942078001 ...
-
Cat# HY-131124,
inquire
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ...
-
No products found
because this supplier's products are not listed.
William N. Voss, et al.,
bioRxiv - Immunology 2024
Quote:
... twelve-month-old female BALB/c mice (Envigo; 2-3 mice per group/harvest time point) were prophylactically injected 12h prior to infection with 200 µg/mouse of either mAb ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
6-Chloro-7-hydroxy-4-methylcoumarin is a pharmaceutical intermediate.
Cat# S5760, SKU# S5760-5mg,
5mg, $107.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Lin Di, et al.,
bioRxiv - Genomics 2022
Quote:
... at 37°C for 1h and purified by Zymo columns ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 35 mm glass bottom dishes (MatTek cat#P35G-1.5-7-C). Neurons were then incubated at 37°C in 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Viren H. Makhijani, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 0.3% Triton X-100 for 2 hours before being incubated in rabbit anti-c-Fos antibody (1:4000 in 3% NGS + 0.1% Triton; Synaptic Systems, Goettingen, Germany; Lot# 226003/3-45) for 16 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Rachel C. Kelley, et al.,
bioRxiv - Physiology 2021
Quote:
... 10x objective lens) connected to a monochrome camera (Axio MRm, 1x c-mount, 2/3” sensor) and Zen Pro software (Carl Zeiss Microscopy). We used semi-automatic muscle analysis using segmentation of histology (SMASH ...
-
No products found
because this supplier's products are not listed.
Senthilvelrajan Kaniyappan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... covered with either 2 nm amorphous carbon (Quantifoil, R2/1+2 nm C) or graphene were used for sample preparation ...
-
No products found
because this supplier's products are not listed.
Adrien Birot, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
No products found
because this supplier's products are not listed.
Peter Proks, et al.,
bioRxiv - Biophysics 2021
Quote:
... NFx and desamino chloro-fluoxetine (Toronto Research Chemicals). NFx was dissolved in DMSO and diluted to working concentrations on the day of experimenting (max final DMSO concentration was 0.3 %) ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Alison Besse, et al.,
bioRxiv - Microbiology 2022
Quote:
... at 37°C in a TC-7 roller drum (New Brunswick) at 240 rpm for 16 h ...
-
No products found
because this supplier's products are not listed.
Jonathan Lautz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and maintained at room temperature for > 1.5 h before recording (34⁰ C; 2-3 ml/min perfusion; Olympus BX-51WI microscope ...
-
No products found
because this supplier's products are not listed.
Eric Batsché, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... treated by RNase A (20 µg/mL) for 1h at 37°C in TE buffer and sonicated 8 min with BioRuptor (Diagenode) (15 sec ON / 15 sec OFF ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 × 105 Huh-7 cells were grown in a 35 mm dish (ibidi) with growth medium ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Anjali Sengar, et al.,
bioRxiv - Microbiology 2023
Quote:
... The membrane was blocked with 5% BSA in TBS containing 0.1% tween-20 (TBS-T) for 1h at 4 °C before incubating with anti-S2 Spike primary antibody (rabbit polyclonal, Sino Biologicals, Cat#: 40590-T62) at 1:1,000 dilution in TBS-T with 5% BSA for 14-16 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Luca Ducoli, et al.,
bioRxiv - Genomics 2020
Quote:
... both transcripts were biotin-labeled after in vitro transcription from 1µg linearized pcDNA3.1-LETR1-1 and pcDNA3.1-LETR1-1-antisense plasmids for 1h at 37°C using Ampliscribe T7-flash biotin-RNA kit (Lucigen). Biotinylated LETR1 sense and antisense RNA were then treated with RNase-free DNase I for additional 15min at 37°C ...
-
No products found
because this supplier's products are not listed.
Chujun Zhang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and the fluorescence intensity of the dye was immediately recorded over a period of 1h at 26°C using a Spark multimode microplate reader (Tecan) with an excitation of 480nm and an emission of 530nm ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Hailong Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
JAK inhibitors pyridine-6 (BioVision, Cat No. 2534) and ruxolitinib (NCB018424 ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1H NMR (JEOL, Tokyo, Japan) (400 MHz ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Ulrich Hohmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and incubated for 1h at 4 °C before being added to 10 µl magnetic V5 beads (v5tma, Chromotek), pre-equilibrated in buffer K ...
-
No products found
because this supplier's products are not listed.
C Chevillard, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 6µg/mL (known bNAbs) were let in contact with the pseudoviruses for 1h at 37°C in 96-w white plates (Greiner #675083), before addition of HeLa ACE2 cells ...
-
No products found
because this supplier's products are not listed.
Heta P. Patel, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and bead beating 7×2 min in a Mini-Beadbeater-96 (Biospec #1001). The lysate was recovered and centrifuged to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Talia Hatkevich, et al.,
bioRxiv - Genetics 2020
Quote:
Antibodies for C(3)G (25) and g-H2Av (Rockland) were used ...
-
No products found
because this supplier's products are not listed.
Sahil Nagpal, et al.,
bioRxiv - Biophysics 2023
Quote:
U-2 OS and COS-7 cells were obtained from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Ana Izabel Silva Balbin Villaverde, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... The plate was incubated at 37°C and fluorescence measurements were taken every 30 sec during a 1h-period using the microplate reader FLUOstar OPTIMA (BMG Labtech, Mornington, VIC, Australia) with excitation and emission wavelengths of 485 and 510 nm ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... and for 1h at RT goat anti-mouse IRDye 680LT (LI-COR) which served as a loading control ...
-
No products found
because this supplier's products are not listed.
Ulschan Bathe, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
100 µL pyridine and 100 µL MSTFA (Macherey-Nagel) were added to dried yeast extracts and incubated for 2 h at 70 °C.
-
No products found
because this supplier's products are not listed.
Jing Yang (John) Wang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 100 mM glycine to glow-discharged C-flat CF-2/2 C-T-grids (TED PELLA).
-
No products found
because this supplier's products are not listed.
Miao-Hsi Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... coverslips were blocked with 2% w/v BSA for 1h and incubated with ACE2 antibody [SN0754] (1:250) (GeneTex, GTX01160), followed by Goat anti-rabbit IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Luna Jammal Salameh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... strains see above) were deeply anesthetized with isoflurane (1-Chloro-2,2,2-trifluoroethyl-difluoromethylether, Abbott, Germany). As described previously in more detail (Dutschmann et al. ...