-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Carole Fruchart Gaillard, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cells were incubated for 2h at 37°C with 5 μg/ml DiI-LDL (1,1’-dioctadecyl-3,3,3’,3’-tetramethyl-indocarbocyanine perchlorate, Cedarlane/Kalen Biomedical) in SFM media before fixation ...
-
No products found
because this supplier's products are not listed.
Mengqi Luo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... overnight at 4 °C and then HRP-conjugated secondary antibody (1:2000, ZEN BIO, China) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
Larvae (7 dpf) were anesthetized with tricaine and injected with 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ~1.114 particles/ml in PBS) just as for the fluorescent tracer injections ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
4-Chloro-3-nitropyridine is a chemical reagent.
Cat# abx183566-5G,
5 g USD $130.5
Ask
Davide Piccolo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Cells were first washed with PBS and then incubated for 1 hour and 30 minutes at 5% CO2 and 37°C or 30°C with the primary antibody (Anti-ABCA4 Abbexa abx130549 1:300) diluted in DMEM containing 10% FBS ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
C Colomer-Winter, et al.,
bioRxiv - Microbiology 2019
Quote:
... wells were coated overnight at 4°C with 100 µg ml-1 human fibrinogen free of plasminogen and von Willebrand Factor (Enzyme Research Laboratory). The next day ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Kellie A. Cotter, et al.,
bioRxiv - Genomics 2022
Quote:
... to reduce uncapped RNAs to 5′ hydroxyls and make them incapable of ligating to 5′ adaptor and Cap-Clip (catalog no. C-CC15011H; Cambio) to remove the 5′ cap of transcripts that had undergone guanylation and allow them to be incorporated into the library through 5′ adapter ligation ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Megan Garland, et al.,
bioRxiv - Microbiology 2019
Quote:
... Frozen stocks were cultured on CDMN agar plates (C. difficile agar base (Oxoid CM0601) supplemented with 7% (v/v) defibrinated horse blood (Lampire Biological Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Alexander Lercher, et al.,
bioRxiv - Immunology 2023
Quote:
Anesthetized mice were intranasally (i.n.) treated with 2×25 µL clodronate liposomes (Liposoma #C-005) 3 days prior to alveolar macrophage transfer ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Jesse R. Holt, et al.,
bioRxiv - Cell Biology 2020
Quote:
Primary keratinocytes sparsely seeded on fibronectin-coated glass-bottom dishes were allowed to migrate freely for up to 16.67 hours at 37°C with 5% CO2 in bath solution composed of Cnt-Pr-D (CellnTec) culture media with extracellular Ca2+ concentration adjusted to 1.2 mM ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Gokhan Unlu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 x105 cells were placed in a microfuge tube and incubated with 2 μM ZnMP (Frontier Scientific) in 1x HBSS for 15 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Dhananjay M. Nawandar, et al.,
bioRxiv - Microbiology 2022
Quote:
... One or two drops of 0.5% proparacaine (McKesson Corp.) were applied to the eye ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and mice were randomized into treatment groups: (n=7) daily oral gavage of 60 mg kg−1 of eliglustat (AbMole BioScience, M9733) or (n=7 ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Tae-Wuk Kim, et al.,
bioRxiv - Plant Biology 2019
Quote:
... or 15N MS medium (1/2 MS without nitrogen source [PhytoTechnology Laboratories] ...
-
No products found
because this supplier's products are not listed.
Florian J. Bock, et al.,
bioRxiv - Cell Biology 2020
Quote:
... S63845 (Chemgood, C-1370), Sytox Green (Thermo ...
-
No products found
because this supplier's products are not listed.
Zhongxiao Fu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Slices were perfused continuously with aCSF bubbling with 5% CO2/95% O2 at flow rate about 2 ml/min using two channels peristaltic pump (Dynamax, Rainin, USA).
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
Recombinant Antigen
Cat# REC31706-100,
100µg USD $492.0
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...