-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
4-Chloro-3-nitropyridine is a chemical reagent.
Cat# abx183566-5G,
5 g USD $130.5
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
Cat# F107,
USD $169.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-mature SP-B (rabbit polyclonal, 1:1000, Seven Hills Bioreagents), both generous gifts from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... Endothelium-intact or -denuded rings were mounted on tungsten wires and immersed in PSS at 37°C with constant gassing (21% O2 and 5% CO2) in a wire myography chamber (DMT 610) and incubated ex vivo with oxLDL (50μg/dL; 2h; Kalen Biomedical, cat. no. 770202-7), followed by normalization and KCL (100mM ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Ivana Jaric, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and then 20 strokes of pestle B (tight pestle) in a glass douncer (7 ml Dounce tissue grinder set, KIMBLE, DWK Life Sciences). The lysate was transferred to an ultracentrifuge tube ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Nao Nishida-Aoki, Taranjit S. Gujral,
bioRxiv - Cancer Biology 2021
Quote:
Jurkat cells were washed with PBS and seeded onto a 24-well transwell culture insert with 3 µm pores (Celltreat Scientific Products ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...