-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Marija Radosevic, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Emily C. Britt, Jing Fan,
bioRxiv - Biochemistry 2020
Quote:
... and 3-2H-glucose (all from Cambridge Isotope), the isotopically labeled glucose was substituted for unlabeled glucose at the same concentration in RPMI culture media ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Antonio Marino, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 4 3 2.0 mm SecurityGuard (Phenomenex) cartridge as a guard column ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
Building Block
Sold for research purposes only.
Cat# 2866.0, SKU# 2866-50 mg,
50mg, US $379.50 / EA, EURO, €345 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
2-Methyltetrahydrofuran-3-one is a volatile constituent of the aroma complex of roasted coffee.
Cat# S6274, SKU# S6274-25ul,
25ul, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Alison Moss, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one of the five tracers was injected into Sprague Dawley rats (3-4 months old, purchased from Envigo) sino-atrial node at the same volume of 10 μL and the heart tissues were harvested in the time window 10 am-12 pm 14 days after injection and stored in OCT immediately ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Wenjian Lv, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were passaged (1:12) every 3-4 days using StemMACS Passaging Solution XF (Miltenyi Biotec) and Y-27632 dihydrochloride (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Joaquín Miguel Pellegrini, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were then incubated with mouse anti-human LC3A/B antibody (MBL International, M152-3) for 20 min ...
-
No products found
because this supplier's products are not listed.
Bharat Ravi Iyengar, Andreas Wagner,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 6-(2-deoxy-beta-D-ribofuranosyl)-3,4-dihydro-8H-pyrimido-[4,5-C] [1,2]oxazin-7-one triphosphate (dPTP, Trilink Biotechnologies), 200nM each of forward and reverse primers ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Yuyang Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 3,4-Dihydro-2H-pyrano[2,3-b]quinolin-7-yl)-(cis-4-methoxycyclohexyl)-methanone (JNJ 16259685) was purchased from HelloBio (Princeton, NJ, USA). N-[4-Chloro-2-[(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)methyl]phenyl]-2-hydroxybenzamide (CPPHA ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Mathijs P. Verhagen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mice were administered 2-3% dextran sodium sulfate (DSS) in their drinking water for 7 days (#0216011050, MP Biomedicals). DSS-driven inflammation and the corresponding mechanisms underlying the consequent PC dedifferentiation were described in previous studies(11 ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Allison K. Meyers, et al.,
bioRxiv - Immunology 2021
Quote:
... LC-3 (Novus Biologicals, no. NB100-2220; 1:500), P62 (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
R. Christopher D. Furniss, et al.,
bioRxiv - Microbiology 2021
Quote:
... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... Labs 1 and 3 used Antibody 1 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Alex Rosenberg, L. David Sibley,
bioRxiv - Microbiology 2020
Quote:
... on Cytation 3 (BioTek) multimode plate imager according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Emily Maguire, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Designated wells were inhibited by pre exposure for 2 hours with 3-a-aminocholestane (20µM, B-0341), LY294002 (10µM, B-0294) or SF1670 (5µM, B-0350) (Echelon Bioscience). Cells were then exposed to ice cold 0.5 M TCA (Trichloroacetic acid T6399 Sigma ...
-
No products found
because this supplier's products are not listed.
Svenja Maurer, et al.,
bioRxiv - Cell Biology 2024
Quote:
Caspase-3 activity as an important initiator of apoptosis was assessed by the AmpliteTM Fluorimetric Caspase 3/7 Assay Kit (AAT Bioquest) and performed according to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Georgina Gyarmati, et al.,
bioRxiv - Physiology 2021
Quote:
... animals underwent brief anesthesia sessions every 3–4 days using 1%–2% isoflurane and the SomnoSuite low-flow anesthesia system (Kent Scientific, Torrington, CT). Body temperature was maintained with a homeothermic blanket system (Harvard Apparatus) ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Tingting Li, et al.,
bioRxiv - Immunology 2021
Quote:
... The gradient concentrations of SARS-CoV-2 S1 or an artificial chimeric construct carrying 3 mutations on B.1.351 RBD and SD614G (B.1.351 S1) (Sino Biological, Beijing, China) were prepared (2-fold dilutions ...
-
No products found
because this supplier's products are not listed.
Bert Vanmechelen, et al.,
bioRxiv - Microbiology 2021
Quote:
... using 3:1 TransIT-LT1 Transfection Reagent (Mirus Bio). Twenty-four hours later ...