-
No products found
because this supplier's products are not listed.
Josep Fita-Torró, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The ribosomal inhibitor (2-(2-Bromophenyl)-2,3-dihydro-1H-naphtho[1,8-de][1,3,2]diazaborine (DAB) was purchased from TCI Europe and applied to yeast cultures at a final concentration of 20μg/ml from a 20mg/ml stock in ethanol ...
-
No products found
because this supplier's products are not listed.
Lani Archer, et al.,
bioRxiv - Plant Biology 2022
Quote:
X-gluc (5-bromo-4-chloro-3-indolyl-b-D-glucopyranosiduronic acid) (Gold Biotechnology, St ...
-
No products found
because this supplier's products are not listed.
E. van der Kouwe, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Nuclear run-on (NRO) assays were performed with 2 biotin-11-NTPs (biotin-11-CTP and biotin-11-UTP, Jena Bioscience) as described in D ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1 mM 2’F-Py (2’F-2’-dCTP and 2’F-2’-dUTP, TriLink Biotechnologies), 1 mM ATP ...
-
No products found
because this supplier's products are not listed.
Ruben Van Paemel, et al.,
bioRxiv - Genomics 2020
Quote:
... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
No products found
because this supplier's products are not listed.
Kristen N. Haggerty, et al.,
bioRxiv - Cell Biology 2023
Quote:
... F(ab’)2-goat anti-mouse IgG CF568 (Biotium Cat# 20109, RRID:AB_10557119), F(ab’)2-goat anti-rabbit IgG CF568 (Biotium Cat# 20099 ...
-
No products found
because this supplier's products are not listed.
Marinelle Rodrigues, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 gr 4-Chloro-DL-phenylalanine (Alfa Aesar, cat. A13323), 15 gr agar per 1 L of media) ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ...
-
No products found
because this supplier's products are not listed.
Erik Schrunk, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 0 plates (Mattek, Ashland, MA, P24G-0-10-F). The plates were pre-treated with 200 μL 50 μg/mL fibronectin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Elisa Vaiani, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... inhibin B and AMH/MIS by 2-site ELISA (Beckman Coulter and Beckman Coulter Gen II ...
-
No products found
because this supplier's products are not listed.
Wen Xiao, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 1 μL Amino-11-ddUTP (10 mM in H2O, Lumiprobe), 8 μL of 5x TdT buffer (Thermo scientific) ...
-
No products found
because this supplier's products are not listed.
Mustafa N. Okur, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SOD-2 (Enzo Life Sciences, #AD1-SOD-110-F), γ-H2AX (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Aleksandra N. Kozyrina, et al.,
bioRxiv - Biophysics 2024
Quote:
Measurements were performed using a Chiaro Nanoindenter System (Optics 11 Life) mounted on Zeiss Axio Observer 7 (Carl Zeiss) with an environmental chamber sustaining 37°C ...
-
No products found
because this supplier's products are not listed.
Manu De Groeve, Bram Laukens, Peter Schotte,
bioRxiv - Microbiology 2023
Quote:
... 2 L or 5 L scale (Biostat B-plus and B-DCU units, Sartorius Stedium Biotech) as previously described [PMID ...
-
No products found
because this supplier's products are not listed.
Katalin Zboray, et al.,
bioRxiv - Molecular Biology 2023
Quote:
All VOCs were purchased from Sigma-Aldrich (except for (5Z)-octa-1,5-dien-3-ol from Toronto Research Chemicals) in the highest available purity ...
-
No products found
because this supplier's products are not listed.
Celsey M. St. Onge, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A total of 23 adult Sprague-Dawley rats (11 M, 12 F) weighing 240-310 g upon arrival served as subjects (Envigo, Frederick, MD). All rats were surgically implanted with an indwelling jugular catheter and vascular access port using previously published methods (Townsend et al. ...
-
No products found
because this supplier's products are not listed.
Caitlin Fowler, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 11 (3M, 8F), respectively (Supplementary Table 1) ...
-
Cat# HY-W004298-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Aracely Acevedo, et al.,
bioRxiv - Biochemistry 2023
Quote:
BT2 (3,6-dichlorobenzo[b]thiophene-2-carboxylic acid) was purchased from MedChemExpress (#HY114855) and all other uncouplers were purchased from Sigma-Aldrich [FCCP (Carbonyl cyanide 4-trifluoromethoxyphenylhydrazine ...
-
No products found
because this supplier's products are not listed.
Alessandra Pisciottani, et al.,
bioRxiv - Neuroscience 2023
Quote:
... At 2 days in vitro (DIV) 20μg/ml BDNF (Proteintech, 450-02-B) was added to the axonal compartment ...
-
No products found
because this supplier's products are not listed.
Lucas P. Henry, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... age-matched (7-10 days post eclosion adults) using Zymo Quick-DNA extraction kit (Zymo D3012). The 16S V1-V2 region was amplified ...
-
No products found
because this supplier's products are not listed.
Lina Schiffer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 11-ketoandrostenedione (4-androsten-3,11,17-trione) and 11-ketotestosterone (4-androsten-17β-ol-3,11-dione) were from Steraloids. The deuterated internal standards 11β-hydroxyandrostenedione-2,2,4,6,6,16,16-D7 (D7-11OHA4) ...
-
No products found
because this supplier's products are not listed.
Serena Cortés-Kaplan, et al.,
bioRxiv - Immunology 2021
Quote:
... was used to dispense 10 μL of each drug (final drug concentration of 10 μM) to columns 2-11 to a total of thirty 96-well V-bottom assay plates (Sarstedt). For the 15 assay plates containing K562-NL cells alone ...
-
No products found
because this supplier's products are not listed.
Fei Jin, et al.,
bioRxiv - Biophysics 2020
Quote:
... 10 μg of OlZAC (10 μl) was mixed with 200 μg of NAPol (Anatrace, dissolved in 2 µl of buffer B) and incubated for 16 hours ...
-
No products found
because this supplier's products are not listed.
Alexander Kapustin, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CD81 (BD Pharmingen™, 555676, B-11, SantaCruz, sc-166029 and M38 clone, NBP1-44861, Novus Biologicals), Syntenin-1 (Abcam ...
-
No products found
because this supplier's products are not listed.
John Tyler Sandberg, et al.,
bioRxiv - Immunology 2021
Quote:
... cryopreserved PBMCs from study subjects were stimulated for 5 days with polyclonal B cell stimulation (1μg/mL R848 and 10 ng/mL rIL-2, Mabtech) in R10 media (RPMI 1640 with 10% FCS ...
-
No products found
because this supplier's products are not listed.
Travis B. Kinder, et al.,
bioRxiv - Immunology 2020
Quote:
300 HLA-B HiBit cells/well were plated into white 1536-well plates (Greiner, Monroe, NC, 789173-F) in 5 uL/well of GM using a Multidrop Combi (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Deepak Timalsina,
bioRxiv - Plant Biology 2020
Quote:
... 11 (Epoch2, BioTek, Instruments, Inc., USA).
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Lihe Chen, Chun-Lin Chou, Mark A. Knepper,
bioRxiv - Systems Biology 2020
Quote:
... The dissociation was carried out in dissection buffer containing collagenase B (1-2 mg/ml) and hyaluronidase (1.2-2 mg/ml, Worthington Biochemical) at 37 °C with frequent agitation for 30 min ...
-
No products found
because this supplier's products are not listed.
Ruifang Li, Sara A Grimm, Paul A Wade,
bioRxiv - Genomics 2021
Quote:
... 11 μL purified CUT&Tag-DNA was used in the reaction (11 μL DNA, 2 μL 10 μM Tn5mC-ReplO1 oligo, 2 μL 10× Ampligase buffer (Lucigen), 2 μL dNTP mix (2.5mM each ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
Chisato Ono, et al.,
bioRxiv - Immunology 2023
Quote:
... in the presence of 22.5 μg/ml anti-Fcrl5 F(ab’)2 Biotin or Rat IgG F(ab’)2 Biotin isotype control (Rockland) and 20 μg/ml streptavidin (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Siavash Khosravi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... dried lipids were re-dissolved in 40% UPLC solvent B (90% 2-propanol/10% acetonitrile/0.1% formic acid/10 mM NH4HCO3) and transferred to silanized glass inserts (Phenomenex) using Hamilton syringes ...
-
No products found
because this supplier's products are not listed.
Xufeng Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... Group 2: Polymyxin B (PMB) (1 mg/kg, i.p., Solarbio, China); Group 3 ...
-
No products found
because this supplier's products are not listed.
Maria-Teresa Jurado-Parras, et al.,
bioRxiv - Neuroscience 2020
Quote:
... was infused (Pump 11 Elite Nanomite, Harvard Apparatus, using a 10 uL WPI Nanofil syringe) in 6 specular sites bilaterally ...
-
No products found
because this supplier's products are not listed.
Tevin CY. Chau, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... anti-PROX1 (AngioBio 11-002), anti-NRP2 (R&D System AF567) ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 × 105 Huh-7 cells were grown in a 35 mm dish (ibidi) with growth medium ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Ana Lucia Rosales Rosas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
7-Deaza-2’-C-Methyladenosine (7-DMA) was purchased from Carbosynth (Berkshire, UK) and dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
LC Laboratories' Product Number G-2822 - Glycitin (Glycitein 7-O-β-D-glucopyranoside ), >99% -...
Cat# G-2822, SKU# G-2822_500mg,
500 mg, $660.00
Ask
Steffen Preissler, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 2 μM PERK inhibitor (PERKi; gift from GSK, GSK2606414) and 10 μg/ml brefeldin A (BFA; LC Laboratories, B-8500). All compounds were diluted freshly in pre-warmed medium and applied to the cells by medium exchange.
-
No products found
because this supplier's products are not listed.
Dillon G. Patterson, et al.,
bioRxiv - Immunology 2021
Quote:
... or intravenously with 50 μg NP-Ficoll (Biosearch Technologies; F-1420-10). For influenza infections ...
-
No products found
because this supplier's products are not listed.
Francois Chesnais, et al.,
bioRxiv - Bioengineering 2022
Quote:
... plates up to passage 7 and maintained in Endothelial Growth Medium 2 (EGM2; Promocell). Normal Human Dermal Fibroblasts (NHDF ...
-
No products found
because this supplier's products are not listed.
Sahil Nagpal, et al.,
bioRxiv - Biophysics 2023
Quote:
U-2 OS and COS-7 cells were obtained from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Mathilde Bergamelli, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Immunostainings were performed with the following antibodies: rabbit anti-Cytokeratin-7 (Genetex; 2 μg/mL), mouse anti-Vimentin (Santa-Cruz ...
-
10-Undecen-1-ol is used as a flavoring agent.
Cat# S6225, SKU# S6225-25ul,
25ul, $97.00
Ask
Faith C. Fowler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... abl pre-B cells were treated with 10 μM RO-3306 (Selleck Chemicals, #S7747) overnight ...
-
No products found
because this supplier's products are not listed.
Luisa Cervantes-Barragan, et al.,
bioRxiv - Immunology 2021
Quote:
... Cultures were maintained in DMEM/Ham’s F-12 medium supplemented with 2% Ultroser G (Pall Corp., France), until all wells had TEER measurements greater than 1000 Ω and deemed ready for use.
-
No products found
because this supplier's products are not listed.
Daniel J. Barrero, et al.,
bioRxiv - Biophysics 2024
Quote:
... 400 mesh electron microscopy grids (01754-F F/C, Ted Pella, Redding CA) for 1 minute ...
-
No products found
because this supplier's products are not listed.
Ashley L. Kalinski, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 160 x g) and trituration in wash buffer (DMEM Ham’s F-12, Gibco, 10565-018; 10% FBS, Atlanta Biologicals, S11550 ...