-
No products found
because this supplier's products are not listed.
Drew E. Glaser, et al.,
bioRxiv - Bioengineering 2020
Quote:
... MCF-7 (Cell Biolabs) breast cancer cells (estrogen and progesterone receptor positive ...
-
No products found
because this supplier's products are not listed.
Marco Leibinger, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 7-dihydroxytryptamine (DHT, Biomol). DHT was dissolved in 0.5 μl of 0.2 % ascorbic acid in saline ...
-
No products found
because this supplier's products are not listed.
Maud de Dieuleveult, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Samples were further stained with 7-AAD or 7-aminoactinomycine (AAT Bioquest, 17501). Data were acquired on a BD AccuriTM C6 flow cytometer (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Xinquan Liu, Debadyuti Ghosh,
bioRxiv - Bioengineering 2019
Quote:
... and Cyanine 7 (Cy7, Lumiprobe) was conjugated to monomeric BSA according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Hiroaki Kaku, Thomas L. Rothstein,
bioRxiv - Cell Biology 2019
Quote:
... after which cells were resuspended in 2 μg/ml 7-aminoactinomycin D (7-AAD) (Anaspec). Cell viability was assessed using Gallios (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Tomasz Czerniak, James P Saenz,
bioRxiv - Biochemistry 2021
Quote:
... 7-deaza-GTP (Trilink Biotechnologies, USA) was used ...
-
No products found
because this supplier's products are not listed.
Himani Sharma, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Biotinylated β-galactosidase (B-βG) and Biotin Alkaline Phosphatase Conjugated (B-ALP) were purchased from Rockland Immunochemicals (PA ...
-
No products found
because this supplier's products are not listed.
Sandhya Manohar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-Aurora B (Bethyl, A300-431) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Rinaldo D. D’Souza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... into one of ten cortical areas and performing iontophoretic injections (3 µA, 7 s on/off cycle for 7 minutes; Midgard current source; Stoelting) of biotinylated dextran amine (BDA ...
-
No products found
because this supplier's products are not listed.
Romain Durand, et al.,
bioRxiv - Genomics 2023
Quote:
... hygromycin B (BioShop Canada), G418 (BioShop Canada) ...
-
No products found
because this supplier's products are not listed.
Namita Chatterjee, et al.,
bioRxiv - Cell Biology 2020
Quote:
... ERN1 (Cat: SR301457A&B, Origene), siRNA Negative Control (Cat ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Shahzad S. Khan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the other group (7 mice) received untreated diet (Research Diets D01060501) for 14 days and served as the control group ...
-
No products found
because this supplier's products are not listed.
Krishna D. Reddy, et al.,
bioRxiv - Biophysics 2021
Quote:
... Dataset B was collected with a K3 Summit direct electron detector (Gatan). Automated data collection was performed in super-resolution counting mode using SerialEM software (Mastronarde ...
-
No products found
because this supplier's products are not listed.
Ivana Jaric, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and then 20 strokes of pestle B (tight pestle) in a glass douncer (7 ml Dounce tissue grinder set, KIMBLE, DWK Life Sciences). The lysate was transferred to an ultracentrifuge tube ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Katja R. Kasimatis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... hygromycin B (A.G. Scientific, Inc.) was added to the plates at a final concentration of 250μg/ml ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Christiane Geithe, et al.,
bioRxiv - Biochemistry 2021
Quote:
We used hybriwell chambers (16 wells, 7 mm x 7 mm x 0.05 mm; RD477991, Grace Bio-Labs, Oregon, USA) that were customized according to our needs ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3-azido-7-hydroxycoumarin was purchased from Biosynth International Inc ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Najet Serradj, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The double layer of dorsal musculature was closed with 7-0 vicryl absorbable surgical suture (Ethicon) and skin closed with 7 mm surgical wound clips (Fine Science Tools). Mice were given 1 ml saline (0.9% solution ...
-
No products found
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Mohamad El Shami, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... amphotericin B (250 ng/mL, Gemini Bio-Products 400104), and Plasmocin (2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Inês Caldeira Brás, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with 100mL culture medium for 7 days containing DMEM (PAN Biotech, Aidenbach, Germany) supplemented with 10% FBS (Anprotec ...
-
No products found
because this supplier's products are not listed.
Emilio Espinoza-Simón, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Temperature was kept at 30 °C using a water bath (PolyScience 7 L, IL). Oxygen consumption reaction mixture was MES 10 mM pH 6 and 500 mg (wet weight ...
-
KDM5A inhibitor
Sold for research purposes only.
Cat# 2674.0, SKU# 2674-5 mg,
5mg, US $137.50 / EA, EURO, €125 / EA
Ask
Durga Praveen Meka, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Spindlactone B (SPL-B; a TACC3 inhibitor; Axon Medchem) – 0.25 µg per ml was added at the time of plating (at 0h) ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Luis Vigetti, et al.,
bioRxiv - Cell Biology 2024
Quote:
... biotinylated ligands (b-X): b-PEG-OH (PEG1207.0100, Iris Biotech, 4847 g/mol), b-PEG-NH2 (PEG1046 ...
-
No products found
because this supplier's products are not listed.
Anna Dopler, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-7 (ImmunoTools, 5ng/ml), IL-15 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
Joel Lang Yi Ang, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and Rhodamine B (A5102, TCI) fluorescence stains were prepared at various concentrations for optimal staining of different tissue types ...
-
No products found
because this supplier's products are not listed.
Andreia R. Fernandes, et al.,
bioRxiv - Cell Biology 2021
Quote:
actin depolymerizer Latrunculin B (Focus Biomolecules) and actin stabilizer Jasplakinolide (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Marta Zaninello, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 250 μg/ml Amphotericin B (Promocell), 1 μM cytosine arabinoside (Sigma) ...
-
No products found
because this supplier's products are not listed.
Tanay Ghosh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in QuantStudio 7 Flex (Applied Biosystems, ABI) machine ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
Schisandrin B is the most abundant dibenzocyclooctadiene lignan present in the traditional...
Cat# S3600, SKU# S3600-10mg,
10mg, $170.00
Ask
Beth Osia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 µM RO3306 (CDK1 inhibitor; Selleck chemicals #S7747) was added and cells were incubated for 6 hours ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Tim J. Viney, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a 7 stranded PerFluoroAlkoxy-coated steel wire (0.002 inch thickness, A-M Systems) was stereotaxically inserted into CA1d to target stratum pyramidale (−2.30 mm antero-posterior (AP ...
-
No products found
because this supplier's products are not listed.
Klamann Linda, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The concentration of chlorophyll a and b in the supernatant was measured using a spectrophotometer (Tecan, Männedorf, Switzerland) at 663 and 645 nm ...
-
No products found
because this supplier's products are not listed.
Celia Segui-Perez, et al.,
bioRxiv - Cell Biology 2022
Quote:
... b-actin (Bioss, bs-0061R), MUC13 (Abcam ...
-
No products found
because this supplier's products are not listed.
Akshatha N. Srinivas, et al.,
bioRxiv - Physiology 2023
Quote:
... 7’-dichlorofluorescein diacetate (DCFH-DA) (BioVision) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Gabriel Antonio S. Minero, et al.,
bioRxiv - Microbiology 2023
Quote:
... and ds B-DNA in a CLARIOstar plate reader (BMG Labtech). Due to variations in fluorescence between samples ...
-
No products found
because this supplier's products are not listed.
Erica A. Birkholz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-7 µl of cells were deposited on R2/1 Cu 200 grids (Quantifoil) that had been glow-discharged for 1 min at 0.19 mbar and 20 mA in a PELCO easiGlow device shortly before use ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The cleared lysate was incubated with an equivalent of 7 μl GFP-trap slurry (Chromotek) for 6 h at 4°C on a rotor ...