-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The following primary antibodies were incubated in antibody buffer (Intercept blocking buffer diluted 1:1 in TBS containing 0.2 % tween 20) at 4 °C overnight: Mouse anti-DSG1/2 (61002, Progen, Heidelberg, Germany), mouse anti-DSP (61003 ...
-
No products found
because this supplier's products are not listed.
Kawsar Hossain, et al.,
bioRxiv - Neuroscience 2024
Quote:
... incubated with EdU reaction solution (4 mM CuSO4, 4 µM Sulfo-Cyanine 3 Azide [Lumiprobe] ...
-
No products found
because this supplier's products are not listed.
Bibiana Rius, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 1.6 mM BTTAA ligand (2-(4-((bis((1-tert-butyl-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)−1 H-1,2,3-triazol-1-yl)acetic acid) (Click Chemistry Tools Scottsdale, Az), and 5 mM sodium ascorbate ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Matteo Rossi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... and then incubated for 1 day at 4°C with Alexa 647 anti-rabbit (Dianova, 711-606-152, 1:300), Cy3 anti-mouse (Dianova 715-166-151 ...
-
No products found
because this supplier's products are not listed.
Shouan Zhu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated overnight at 4°C with antibody anti-SIRT5 (Lifespan Biosciences, 1:100 dilution) or MaK (CST ...
-
No products found
because this supplier's products are not listed.
Morgane Batzenschlager, et al.,
bioRxiv - Plant Biology 2023
Quote:
... the fluorescence emitted by GUS-mediated hydrolysis of 4-MUG into 4-Methylumbelliferone (4-MU) was measured using a microplate reader (POLARstar Omega, BMG LABTECH). Fluorescence was recorded at 360 nm excitation and 460 nm emission filter (gain 500 ...
-
No products found
because this supplier's products are not listed.
Anne Bourdais, Benoit Dehapiot, Guillaume Halet,
bioRxiv - Cell Biology 2021
Quote:
... then individually transferred into small (5 µl) drops of fixative (5:1:4 of methanol:acetic acid:water) on a glass-bottom dish (Mattek). After the zona pellucida had gradually dissolved ...
-
No products found
because this supplier's products are not listed.
Carena Cornelssen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... using 4% paraformaldehyde (Thomas Scientific) in 1x phosphate buffer saline (Dulbecco’s) ...
-
No products found
because this supplier's products are not listed.
Maximilian W. G. Schneider, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 4 mM glucose (AMRESCO, 0188)) ...
-
No products found
because this supplier's products are not listed.
Tabitha E. Hoornweg, et al.,
bioRxiv - Microbiology 2020
Quote:
... Individual plasmids or a combination of the gH and gL expression plasmids (4:1 ratio) were transfected into HEK293T cells using polyethylenimine (PolyScience) as described previously (33) ...
-
No products found
because this supplier's products are not listed.
Marco E. Zamora, et al.,
bioRxiv - Bioengineering 2023
Quote:
... An organic phase containing a mixture of lipids dissolved in ethanol at a designated molar ratio (Fig 1C and Supp Table 1) was mixed with an aqueous phase (50 mM citrate buffer, pH 4) containing Luciferase mRNA (TriLink) at a flow rate ratio of 1:3 and at a total lipid/mRNA weight ratio of 40:1 in a microfluidic mixing device (NanoAssemblr Ignite ...
-
No products found
because this supplier's products are not listed.
C Cintas, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human pancreatic cell lines (Capan-1, BxPC-3, PANC-1, MIA PaCa-2) came from American Type Culture Collection (ATCC), human acute myeloid leukemia cell line (MOLM4 ...
-
No products found
because this supplier's products are not listed.
Tomoya Sasahara, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Counterstaining was carried out with 4’,6-diamidino-2-phenylindole (DAPI, 1:500; Dojindo Molecular Technologies, Kumamoto, Japan). Fluorescence images were acquired with a confocal laser-scanning microscope LSM710 (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Jin Nakashima, et al.,
bioRxiv - Plant Biology 2023
Quote:
... E-XEGP (xyloglucan-specific endo-β-(1→4)-glucanase (Megazyme, Wicklow, Ireland) by adding 10 μl endoglucanase solution (0.4U/μl ...
-
No products found
because this supplier's products are not listed.
Hira Khan, Takashi Ochi,
bioRxiv - Plant Biology 2023
Quote:
... 100 mM EDTA and 1 μl of 4 mg/ml Proteinase K (ApexBio Technology) and incubating for 30 min at 50°C ...
-
No products found
because this supplier's products are not listed.
Jonathan Tai, et al.,
bioRxiv - Biochemistry 2023
Quote:
... [1-14C]-IPP and [phenyl-14C]-4-HB were purchased from American Radiolabeled Chemicals. At each time point ...
-
No products found
because this supplier's products are not listed.
Prerna Arora, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... the supernatant was removed and cell pellets were incubated with 100 μl of solACE2-Fc (1:100 in PBS/BSA) and rotated for 1 h at 4 °C using a Rotospin eppi rotator disk (IKA). After incubation ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 4-1BB (Acrobiosystems) or BSA (Solarbio ...
-
No products found
because this supplier's products are not listed.
Sheng Zhang, et al.,
bioRxiv - Immunology 2022
Quote:
... or iii) 50 ng/ml rm-CSF-1 plus 10 ng/ml IL-4 (ImmunoTools, 681680) and 10 ng/ml IL-13 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
Meiyan Jin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Blots were incubated overnight at 4°C with primary antibodies targeting Tag(CGY)FP (1:2000 dilution in 1% milk, Evrogen, Cat#: AB121), HaloTag (1:1000 dilution in 0.5% milk ...
-
No products found
because this supplier's products are not listed.
Alexis S Mobley, et al.,
bioRxiv - Immunology 2021
Quote:
... and APC-IL-4 (Tonbo Bioscience) for 30 minutes at 4◦C ...
-
No products found
because this supplier's products are not listed.
Gabriela Souza Barbosa, et al.,
bioRxiv - Physiology 2023
Quote:
Male and female C57Bl/6 mice (6-8 weeks of age) were divided into 4 groups and fed either a normal diet (ND; Research Diets, D12328 ...
-
No products found
because this supplier's products are not listed.
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
No products found
because this supplier's products are not listed.
Christopher W Fell, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were washed once with PBS and incubated for 4 hours with 100µg/ml fluoresceinamine labelled glycosaminoglycans: 4-O-sulfated chondroitin sulphate (AMS.CSR-FACS-A1, AMSBIO), poly-sulphated chondroitin sulphate (AMS.CSR-FACS-P1 ...
-
No products found
because this supplier's products are not listed.
Ariane Zutz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The isolated fractions were separated on SDS-PAGE (RunBlue 4-20 %, Expedeon; NuPAGE®Bis-Tris gel 4-12%, Invitrogen) and analysed by InstantBlue staining (Expedeon ...
-
No products found
because this supplier's products are not listed.
Angela M. Phillips, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... and 4% polyethylene glycol 200 (Hampton Research, #HR2-084), respectively ...
-
No products found
because this supplier's products are not listed.
Lei Chen, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... ATPase (MBL International Corp. D032-3, 1:200), P63 (Santa Cruz sc-8343 ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Daniela Saderi, Brad N. Buran, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... 1 to 4 high-impedance tungsten microelectrodes (FHC or A-M Systems, impedance 1-5 MΩ) were slowly advanced into cortex with independent motorized microdrives (Alpha-Omega) ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Shivneet K. Gill, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Dilutions of human serum (Human Serum age 4-6, Innovative Research) were performed in TBSM ...
-
No products found
because this supplier's products are not listed.
Irina Sbornova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Whole eye blots were probed overnight at 4 °C with 1 of two PDE11A antibodies: the pan-PDE11A antibody PD11-112 (1:1000, rabbit, Fabgennix) or the PDE11A4-specific antibody PDE11A#1-8113A (1:10,000 ...
-
No products found
because this supplier's products are not listed.
Rong Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then incubated in primary antibody at 4 °C for 72 hr (1:1,000 chicken anti-GFP, Abcam, ab13970; 1:5000 rabbit anti-fractin, Phosphosolutions, 592-FRAC). Sections were washed several times in TBS ...
-
No products found
because this supplier's products are not listed.
Jie E. Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit IgG (Cocalico Biologicals, 1 mg/ml, diluted 1:1000); 4) anti-3A (KDLKIDIKTSPPPEC; (Richards et al., 2014)) rabbit IgG (Biomatik, 0.6 mg/ml, diluted 1:500). Protein derived from extracellular vesicles (20 µg per lane ...
-
No products found
because this supplier's products are not listed.
Lora Kovacheva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... gabazine (SR95531, 4 µM; Biotrend) and DL-AP5 (10 µM ...
-
No products found
because this supplier's products are not listed.
Enrico Radaelli, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 4-Hydroxynonenal (HNE, Alpha Diagnostic International HNE11-S ...
-
No products found
because this supplier's products are not listed.
Siqi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... then resuspended and incubated at 4°C for 1 hour in CUT&RUN antibody buffer and 2.5 μL pAG-MNase (EpiCypher). ConA-bound-nuclei were then washed twice with CUT&RUN triton wash buffer ...
-
No products found
because this supplier's products are not listed.
Kimberly E. Stephens, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Cat# 1706404) and incubated overnight at 4°C with primary rabbit polyclonal anti-CEBPG antibody (1:1000; MyBioSource, Cat# MBS8241686) and anti-β-actin antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Anqi Zhang, et al.,
bioRxiv - Bioengineering 2023
Quote:
4-0 silk sutures (Fine Science Tools) were used to ligate the ECA and temporarily stop blood flow in CCA and posterior auricular artery (PAA) ...
-
No products found
because this supplier's products are not listed.
Xueqin Li, et al.,
bioRxiv - Cell Biology 2019
Quote:
... DNA (3 μg) was sonicated at intensity 4 for 200 cycles per burst for 55 s (Covaris S2), and DNA fragments were end-repaired ...
-
No products found
because this supplier's products are not listed.
Sutanuka Chakraborty, et al.,
bioRxiv - Microbiology 2020
Quote:
All the flow cytometry data analyses were performed using FCS Express 4 and 6 versions (De Novo Software, Los Angeles, CA).
-
No products found
because this supplier's products are not listed.
Sangderk Lee, et al.,
bioRxiv - Neuroscience 2023
Quote:
... plated into a single well of a 6 well dish that was precoated with Matrigel solution (.4% dissolved in complete astrocyte medium; ScienCell #254277) and grown for two days at 37°C ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...