-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2-(4-((bis((1-(tert-butyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazol-1-yl)acetic acid (BTTAA, Click Chemistry Tools > 95%), Click-IT™ Fucose Alkyne (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
François Halloy, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 5-(Benzylthio)-1H-tetrazole (Carbosynth) was used at 0.24 M concentration in dry acetonitrile to activate the phosphoramidites for coupling ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Bibek Aryal, et al.,
bioRxiv - Plant Biology 2022
Quote:
... CLX or indole (50 μM) was quantified using a Cytation 5 reader (BioTek Instruments).
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Nikita Subedi, et al.,
bioRxiv - Immunology 2022
Quote:
... Channels were subsequently treated with a 5% (v/v) silane (1H,1H,2H,2H-Perfluorooctyltriethoxysilane; Fluorochem, Catalog no. S13150) solution in fluorinated oil (Novec HFE7500, 3M, Catalog no. 51243) and thermally bonded for 12 hours at 600C ...
-
No products found
because this supplier's products are not listed.
Andrew Shum, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 23mm well fluoro dishes (World Precision Instruments). The intracellular free calcium concentration ([Ca2+]i ...
-
No products found
because this supplier's products are not listed.
Julia Fadjukov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Patch pipettes (5–7 MΩ, BF120-69-10, Sutter Instruments) were filled with an intracellular solution composed of (in mM) ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... After 5-7 days of expansion with BEGM media (Lonza #CC-3170), air-liquid interface (ALI ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
5-Methyl-7-methoxyisoflavone is a chemical compound commonly used as a bodybuilding supplement.
Cat# S9139, SKU# S9139-25mg,
25mg, $107.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Kuan-Ting Huang, et al.,
bioRxiv - Biochemistry 2022
Quote:
Copper Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Cu-TBTA; Lumiprobe, cat. no. 21050)
-
Cat# HY-79635-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Martijn Cordes, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng/ml human IL-7 (Miltenyi Biotec), and 5 ng/ml human FLT3L (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Kathrin S. Jutzeler, et al.,
bioRxiv - Microbiology 2024
Quote:
... We infected 5 female BALB/c and 5 female C57BL/6 mice (Envigo, 7-9 weeks old) per parasite population with 50 cercariae via tail immersion [26] ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Z-RLRGG-7-amino-4-methyl-courmarin (peptide-AMC) was purchased from Bachem. Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1H NMR (JEOL, Tokyo, Japan) (400 MHz ...
-
No products found
because this supplier's products are not listed.
Tarjani M. Thaker, et al.,
bioRxiv - Biophysics 2021
Quote:
... double-Cysteine mutants generated on the C-less background of BmrCD were eluted following Ni-NTA purification and labeled with 20-fold molar excess of 1-oxyl-2,2,5,5-tetramethylpyrroline-3-methyl methanethiosulfonate (Enzo Life Sciences) at room temperature in the dark over a 4 h period ...
-
No products found
because this supplier's products are not listed.
Alice L. Herneisen, et al.,
bioRxiv - Microbiology 2023
Quote:
... The membrane was incubated in secondary antibody solution (1:10,000 Goat anti-Mouse IgG IRDye 800 or 680) in 5% milk/TBS-T for 1h at room temperature and was visualized by LI-COR Odyssey CLx ...
-
No products found
because this supplier's products are not listed.
Damián Balfagón, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and N-Methyl-N-(trimethylsilyl)trifluoroacetamide (Macherey-Nagel). Fatty acid methyl esters (C8-C24 ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Takeshi Hiramoto, et al.,
bioRxiv - Neuroscience 2021
Quote:
... nadic methyl anhydride (NMA, Polysciences Inc., cat# 00886–500), and 2,4,6-Tris-(dimethylaminomethyl)phenol (DMP- 30 ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Pazhanichamy Kalailingam, et al.,
bioRxiv - Pathology 2024
Quote:
... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
No products found
because this supplier's products are not listed.
Philip J.M. Brouwer, et al.,
bioRxiv - Immunology 2023
Quote:
... Fluoro-octyl maltoside or lauryl maltose neopentyl glycol (Anatrace) were added to protein samples immediately before their applications to grids at final concentrations of 0.02 w/v% and 5 µM ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... [[[(1S)-1-(4-Bromophenyl)ethyl]amino](1,2,3,4-tetrahydro-2,3-dioxo-5-quinoxalinyl)methyl] phosphonic acid tetrasodium salt (PEAQX; HelloBio).
-
No products found
because this supplier's products are not listed.
V. E. Dunlock, et al.,
bioRxiv - Immunology 2019
Quote:
... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Taotao Sheng, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Adapter-ligated DNA was subjected to immunoprecipitation with a primary monoclonal antibody against 5-methyl cytosine (Diagenode C15200081) using a previously published protocol [71] ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Cynthia M. Arokiaraj, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Cyanine 3 and Cyanine 5 reagents from Akoya Biosciences at 1:1500 ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
Shuntaro Morikawa, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Fluorescence for cell viability and luminescence for caspase-3/7 activity was measured using Infinite M1000 plate reader (Tecan). Caspase-3/7 activity was normalized to cell viability according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Filippo Macchi, Eric Edsinger, Kirsten C. Sadler,
bioRxiv - Genomics 2022
Quote:
... or anti-5-methyl-cytosine (5mC – Aviva Biosystem clone 33D3 ...
-
No products found
because this supplier's products are not listed.
Sujung Choi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... -H3K27 di-and tri-methyl (H3K27me2/3, Active Motif, cat # 39538), -nuclear pore glycoprotein p62 (NUP62 ...
-
No products found
because this supplier's products are not listed.
Hailing Zong, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 70 µl of cells at 5-7×105 cells/ml were seeded into a Culture-Insert 2 Well (ibidi) and grown to confluency ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...