-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Doosan Shin, et al.,
bioRxiv - Plant Biology 2023
Quote:
... To detect sinapoylmalate and intact indole-3-methyl glucosinolate (I3M) contents, an AcclaimTM RSLC120 C18 column (100 mm x 3 mm, 2.2 µm) (ThermoFisher Scientific, MA) was used in conjunction with mobile phases consisting of solvent A (0.1% formic acid (v/v ...
-
No products found
because this supplier's products are not listed.
Fushun Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251, 5 µM, Tocris); Tetrodotoxin (TTX ...
-
No products found
because this supplier's products are not listed.
Ethan W. Morgan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Indole-3-propionic acid and indole-3-lactic acid were from Alfa Aesar (Heysham, UK). AIN93G was purchased from Dyets ...
-
No products found
because this supplier's products are not listed.
Joseph O. Magliozzi, James B. Moseley,
bioRxiv - Cell Biology 2021
Quote:
... all strains were grown in YE4S at 32°C and treated with 30 μM 3-Brb-PP1 (3-[(3-Bromophenyl)methyl]-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (Abcam) for 1 h and fixed in ice-cold 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Devin Dersh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-CIITA (clone 7-1H, Santa Cruz); anti-B2M (Dako) ...
-
No products found
because this supplier's products are not listed.
Valeria Scagliotti, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Amanda N.D. Adams, et al.,
bioRxiv - Microbiology 2021
Quote:
... 200µg/ml 5’-fluoro-2’-deoxyuridine (VWR), 100ng/ml anhydrotetracycline (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jonathan So, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 mM of IncuCyte Caspase-3/7 Green Apoptosis Assay Reagent (Sartorius, cat #4440) as well as 1:500 of Nuclight Rapid Red Dye (Sartorius ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Yufang Ding, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Indole-3-acetate sodium salt (I3A) was purchased from Cayman chemicals (Ann Arbor, MI). All other chemicals were purchased from VWR (Radnor ...
-
No products found
because this supplier's products are not listed.
Bradley R Corr, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5′-bromo-2′-deoxyuridine (BrdU) (Cat. #550891; BD Biosciences; RRID:AB_2868906) was then added directly to the well culture media (final concentration 10 µM) ...
-
No products found
because this supplier's products are not listed.
Mitchell G. Kluesner, et al.,
bioRxiv - Bioengineering 2020
Quote:
... IL-7 (5 ng/mL, PeproTech), and IL-15 (5 ng/mL ...
-
No products found
because this supplier's products are not listed.
Marc-Jan Gubbels, et al.,
bioRxiv - Microbiology 2020
Quote:
... and two additional 5 min washes with PBS before mounting with Fluoro-Gel (Electron Microscopy Sciences). A Zeiss Axiovert 200 M wide-field fluorescence microscope was used to collect images ...
-
No products found
because this supplier's products are not listed.
Aashiq H. Mirza, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... USA (Catalog No. S3190) and 7-Methyl-guanosine-5’-monophosphate (m7GMP) was purchased from Jena Bioscience, Jena ...
-
No products found
because this supplier's products are not listed.
Paweł Czerniawski, et al.,
bioRxiv - Plant Biology 2022
Quote:
... camalexin and indole-3-acetonitrile (IAN) were performed using Agilent 1200 HPLC System (Agilent, USA) equipped with diode array and fluorescence (FLD ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Huiru Sun, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... WCLs were incubated with 50 μl 7-methyl-GTP Sepharose 4B beads (GE Healthcare) for 2 h at 4 °C ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... and 5 μl 7-AAD (Biolegend) were added ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Brian J. Thomas, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
No products found
because this supplier's products are not listed.
R. Wercberger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2% Fluoro-Gold (Fluorochrome), or the HSV-hEF1a-GFP-L10a.
-
No products found
because this supplier's products are not listed.
Ole A.W. Haabeth, et al.,
bioRxiv - Immunology 2021
Quote:
... After washing wells were incubated with a 5-bromo-4-chloro-3⍰-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (R&D systems, mouse IFNγ Kit Cat # EL485). Plates were scanned and analyzed using ImmunoSpot Microanalyzer.
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Nicole G. Bender, et al.,
bioRxiv - Immunology 2020
Quote:
... female outbred CD1 mice (N=5) aged 5-7 weeks (Charles River) were immunized with 20 μg of either wheat germ cell-free expressed UF1 ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... IL-7 (5 ng/mL) (Stemcell Technologies, Cat.#78053), IL-15 (5 ng/mL ...
-
No products found
because this supplier's products are not listed.
Justin A. Peruzzi, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Cyanine 7) (Cy 7 PE) were purchased from Avanti Polar Lipids. 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl ...
-
No products found
because this supplier's products are not listed.
Alexandra A. Vetrova, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Sections (5-7 μm thick) were cut using Reichert-Jung (Leica) Ultra-cut 701701 ultramicrotome (Reichert-Jung ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Patarasuda Chaisupa, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Deuterated indole-3-acetic acid (d7-IAA, Cambridge Isotope Laboratories) was used as an internal standard at a concentration of 75 nM in all samples and standards ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).