-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... (4-(1,2,4,5-tetrzain-3-yl)phenyl)methanamine (tetrazine amine) was purchased from Kerafast (FCC659, lot: 2014). 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine ...
-
No products found
because this supplier's products are not listed.
Alessandro Bonadio, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
No products found
because this supplier's products are not listed.
Yilin Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cdh5-CreERT2 mice (3 Kate2 vs. 4 HDAC6) were fed with a control liquid diet (F1259SP, Bio-Serv) for 10 days and were sacrificed for sample collection ...
-
No products found
because this supplier's products are not listed.
Marijke I. Zonneveld, et al.,
bioRxiv - Immunology 2020
Quote:
10×106 cells/ml CD4+CD45RA+ T cells were cultured for 3 days in the presence of 1.5 µg/ml plate bound αCD3 (CLB-T3/4.E, 1XE Sanquin) and 1 µg/ml soluble αCD28 (CLB-CD28/1 ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
Raj Kumar Sadhu, et al.,
bioRxiv - Biophysics 2022
Quote:
... Flash Red polystyrene beads (Bangs Laboratories Inc., 7 µm diameter) were washed three times in sterile PBS and opsonized overnight at 4°C in 3 mg/mL mouse IgG (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 4-1BB (Acrobiosystems) or BSA (Solarbio ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and perfused at 6-7 mL/min by a peristaltic pump (#Masterflex C/L; Cole-Parmer) on an infrared differential interference microscope (#BX51WI ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Benjamin S. O’Brien, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 7% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNA was extracted from mouse brain lysates (mixture of 3∼4 mouse brains for each sample) using RNAprep pure Tissue Kit (Tiangen, DP431). cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme ...
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Jinyuan Vero Li, et al.,
bioRxiv - Biophysics 2020
Quote:
... The nanogold was silver enhanced for 7 min using an HQ silver enhancement kit (Cat# 2012-45 mL, Nanoprobes). The silver was further stabilised by gold toning that involved 15 min incubation in 2% w/v sodium acetate ...
-
No products found
because this supplier's products are not listed.
Hankum Park, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The sequences and properties of all peptides are provided in Supplementary Data Table 7 and were synthesized commercially by Biomatik and Thermo Fischer Scientific ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...