-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... Cells were treated 2h at 37°C with neutrophil elastase (Elastin Products Company), cathepsin G (Biocentrum) ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Lone Buchwaldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 × 7 cm pieces of stretched Parafilm (Bemis Company Inc, Oshkosh, WI, USA) with the mycelium facing up ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Virginia Savy, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3-week-old females were primed by intraperitoneal injection of 5 IU of equine chorionic gonadotropin (Lee Biosolutions, Maryland Heights, MO) followed 46–48 h later by 5 IU human chorionic gonadotropin (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Linlin Yang, et al.,
bioRxiv - Immunology 2020
Quote:
Transgenic larvae were injected at 3 dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Sei Motouchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with 5 µg/mL HIV-1 JR-CSF gp120 (Immune Technology) in coating buffer ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Yijiun Zhang, Joachim Seemann,
bioRxiv - Cell Biology 2023
Quote:
... 5 µl rabbit polyclonal anti- GM130 serum (Wei and Seemann, 2009b) or 1 µg rabbit IgG (ImmunoReagents) as control ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Zhongwen Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... the substrates were then incubated with a solution of 5 nM of ephrinA1-Alexa 680 and 1 μ g/ml of RGD-PEG-PEG-biotin (Peptides international) for 60 min for surface functionalization ...
-
Brdu is a small molecule.
Cat# abx082348-5G,
5 g USD $261.0
Ask
Davide Piccolo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Cells were first washed with PBS and then incubated for 1 hour and 30 minutes at 5% CO2 and 37°C or 30°C with the primary antibody (Anti-ABCA4 Abbexa abx130549 1:300) diluted in DMEM containing 10% FBS ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
Cat# F101,
USD $80.00/EA
Ask
Bocheng Yin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The stock solution of 0.5 M biotin-dPEG®3-benzophenone (biotin-BP, 10267, Quanta BioDesign) in anhydrous DMSO (89139-666 ...
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... PDE11A (FabGennix PD11-112 at 1:100; Aves custom PDE11A4 #1 at 1:10,000; Fabgennix PPD11A-140AP at 1:1000; Fabgennix PPD11A-150AP at 1:500), NF-L (Cell Signaling #2837 at 1:10,000) ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPVI (JAQ1-FITC, #M011-1, Emfret Analytics, 1:10), integrin α5 (CD49e ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...