-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Tristan Lerbs, et al.,
bioRxiv - Immunology 2020
Quote:
We used a One Step Trichrome Stain Kit (American MasterTech). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Natalia Gebara, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 2% Chang Medium C (Irvine Scientific), 20% Fetal Calf Serum (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
Cat# F107,
USD $169.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Rashmi Chandra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... loaded with one zirconia silica bead (2.3 mm, OPS Diagnostics) per well ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells were transferred to 1-2 L roller bottles (Celltreat, USA) and grown in a shaking incubator operating at 8% CO2 and rotating at 125 rpm ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Nicholas B. Karabin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 1 µg of each protein sample was separated in one dimension using 4-20% tris-glycine gels (Mini-PROTEAN TGX, Bio-Rad Laboratories, Inc.). A 1:6 dilution of the PageRuler Plus pre-stained protein ladder (10 µl ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
David Z. Bushhouse, Julius B. Lucks,
bioRxiv - Molecular Biology 2022
Quote:
... using EconoSpin® All-in-One mini spin columns (Epoch Life Science). IVT linear template was eluted from spin columns using 50 μL UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Zachary C. Holmes, et al.,
bioRxiv - Microbiology 2021
Quote:
... their urine was subjected to a pregnancy test (Quidel QuickView One-Step hCG Urine Test) to minimize the risk that prebiotic treatment would impact newborn or infant health ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Jian Xing, et al.,
bioRxiv - Neuroscience 2022
Quote:
... axons were visualized at 2 weeks after optic nerve injury by immunostaining with the anti-CTB antibody (1:500; rabbit, GWB-7B96E4, GenWay) and fluorescent dye-conjugated secondary antibodies (1:500 ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... ELISAs specific for the lectin pathway contained single 1 μM concentrations of FbpC-C or BBK32-C incubated with 2% C1q-depleted NHS (Complement Technologies). Serum incubations were performed in complement ELISA buffer (10 mM HEPES pH 7.3 ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Nihal Karakaş, et al.,
bioRxiv - Immunology 2023
Quote:
... ß-actin (1: 5000, Abbkine), α-tubulin (1 ...