-
This antibody is a mouse monoclonal antibody that is capable of binding to C3.
Cat# MRO-0378-CN,
Inquiry
Ask
Audrey Baylet, et al.,
bioRxiv - Immunology 2021
Quote:
... and 11 µM anti-CD44 scFv (Creative Biolabs, U.S.A.) or anti-CD44 Ab (Thermofisher Scientific ...
-
No products found
because this supplier's products are not listed.
Anastasia C. Christinaki, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... using the Seqman tool of Lasergene Suite 11 (DNASTAR Inc., Madison, WI) (Burland ...
-
No products found
because this supplier's products are not listed.
Astrid M. Alsema, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Reads from bulk samples were deduplicated using a bash script by BIOO Scientific (v2, date 11/1/14), using the NEXTflex barcode that was saved in the additional file ...
-
No products found
because this supplier's products are not listed.
Riti Gupta, Dmitri Toptygin, Christian M. Kaiser,
bioRxiv - Biochemistry 2020
Quote:
The codon optimized 11S sequence was obtained as a synthetic DNA fragment (IDT DNA) and cloned into a His-SUMO backbone (Addgene Plasmid #37507 ...
-
No products found
because this supplier's products are not listed.
Jensen H. C. Yiu, et al.,
bioRxiv - Systems Biology 2023
Quote:
Immunoblotting was conducted as described previously.11 The anti-flagellin antibodies were purchased from Covalab Inc ...
-
No products found
because this supplier's products are not listed.
Daniela Corrales, et al.,
bioRxiv - Microbiology 2023
Quote:
... mk+) supE44 thi-1 recA1 gyrA96 relA1 lac[F′ proA+B+ lacIq ΔlacZM15:Tn10(TcR)]) chemically competent cells (NZYtech) were used as an intermediate host for cloning purposes and they were grow in LB medium at 37 °C under agitation ...
-
No products found
because this supplier's products are not listed.
John L. Chodkowski, Ashley Shade,
bioRxiv - Microbiology 2022
Quote:
... DNA was extracted from all 11 cultures using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, Norcross, GA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nancy Kendrick, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Fourteen human lung tumor and 11 control lung samples were purchased in two groups from a human biobank (ILS Bio, LLC, now BioIVT) Chesterfield ...
-
No products found
because this supplier's products are not listed.
Victoria E. Brings, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the surface of the right hind paw was sterilized and a 5-mm incision was made through the skin starting 2 mm from the heel using a type 11 scalpel blade (McKesson, Richmond, VA). The flexor digitorum brevis muscle was pulled up to isolate ...
-
No products found
because this supplier's products are not listed.
Christopher R. Friesen, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... semen was collected from the female’s cloaca by pulling the ejaculate into a 1 mL syringe (Olsson, 2001) preloaded with 100 µL Hams F-10 medium (Cat # 99175, Irvine Scientific, Santa Ana ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
10 mM of 10 kDa 4-arm PEG-maleimide (Jenkem Technology, Plano, TX) was reacted with 2mM of the lung integrin-binding peptide cocktail for 10 minutes in 0.5X PBS at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
Cat# 329217-07-4,
Inquire
Ask
Ana C. Puhl, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
Pyronaridine tetraphosphate [4-[(7-Chloro-2-methoxybenzo[b][1,5]naphthyridin-10-yl)amino]-2,6-bis(1-pyrrolidinylmethyl)phenol phosphate (1:4)] (12) was purchased from BOC Sciences (Shirley NY). The purity of this compound was greater than 95% ...
-
No products found
because this supplier's products are not listed.
Lina Marcela Carmona, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A total of 10 nL of 4% FluoroGold (Fluorochrome) was injected ...
-
No products found
because this supplier's products are not listed.
Francesca Murganti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Cells were fixed with 4% formaldehyde solution in PBS for 10 min and stained overnight at 4 °C with primary antibodies against mVenus (1:800, Biorbyt, orb334993) and mCherry (1:250 ...
-
No products found
because this supplier's products are not listed.
Lina Sagert, et al.,
bioRxiv - Biochemistry 2023
Quote:
Culture media was harvested at 500×g for 10 min prior to dialysis (Spectra/Por 7, cellulose, 3.5 kDa MWCO, Spectrum Labs) in phosphate-buffered saline (1×PBS pH 7.6 ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPVI (JAQ1-FITC, #M011-1, Emfret Analytics, 1:10), integrin α5 (CD49e ...
-
No products found
because this supplier's products are not listed.
Nuria Masachs, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
No products found
because this supplier's products are not listed.
Benjamin L.L. Clayton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... then luciferase activity was measured with the One-Step Luciferase Assay System (BPS Bioscience, 60690-1) according to manufacturer’s instructions with a Synergy Neo2 plate reader (BioTek).
-
No products found
because this supplier's products are not listed.
Florent Peglion, et al.,
bioRxiv - Cell Biology 2021
Quote:
... VO-OHpic (Tebu-bio, Ref#B-0351), Compound C (CC ...
-
No products found
because this supplier's products are not listed.
Aubin Moutal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or VEGF-B (1nM, Cat#RPU44324, Biomatik) for 30 min before recording ...
-
No products found
because this supplier's products are not listed.
Stephen Dela Ahator, Wang Jianhe, Lian-Hui Zhang,
bioRxiv - Microbiology 2020
Quote:
... One step Qrt-PCR reaction was performed using the Tiangen One-step SYBR Green kit (Tiangen, China) in the Applied Biosystems QuantStudio 6 Flex RT-PCR System.
-
No products found
because this supplier's products are not listed.
Christopher J. DiRusso, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 0.4 M solution of 2-(7-aza-1Hbenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (Chem-Impex International) was prepared in DMF and 2.5 ml was used to dissolve 1 mmol of each Nα Fmoc-protected aa (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
No products found
because this supplier's products are not listed.
Ethan Iverson, et al.,
bioRxiv - Microbiology 2021
Quote:
... IFNλ3 (10 nM, 11730-1, PBL Assay Science), Ruxolitinib (2 μM ...
-
No products found
because this supplier's products are not listed.
Charles W. Dickey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Patient 1-10 recordings were collected from PMT electrodes (PMT Corporation ...
-
No products found
because this supplier's products are not listed.
Nicole Wagner, Mark P. Foster,
bioRxiv - Biochemistry 2021
Quote:
... pH 7) to a concentration of 25 μM and placed into a 1 mm path length quartz cuvette (Starna Cells). NMR buffer with no DNA was used as a blank ...
-
No products found
because this supplier's products are not listed.
Deborah D. Chin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dried samples were imaged on JEM 2100-F (JEOL Ltd., Tokyo, Japan).
-
No products found
because this supplier's products are not listed.
Daniel P. Salem, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 0.1% Pluronic F-68 (P1169, Spectrum Chemical, New Brunswick, NJ, USA). The antibody-functionalized magnetic beads were resuspended in 1 mL of 1X PBS ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Hirashima, Michiyuki Matsuda,
bioRxiv - Developmental Biology 2022
Quote:
... or DAPI (Dojindo Molecular Technologies, #D523-10, 1:200). The samples were mounted with 10 µL of 1% agarose gel onto a glass-based dish (Greiner Bio-One ...
-
No products found
because this supplier's products are not listed.
Jordan B. Burton, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... using a micro electrode (1–10 µL/min; SCIEX). The solvent system consisted of 0.1% FA in water (solvent A ...
-
No products found
because this supplier's products are not listed.
Amy E. Campbell, et al.,
bioRxiv - Genomics 2022
Quote:
... the unreacted hydroxyl groups were acetylated by conventional capping reagents (Cap A: Tetrahydrofuran/Acetic Anhydride and Cap B: 16% 1-Methylimidazole in Tetrahydrofuran; Glen Research). The 5’-DMT protecting group on the resulting dinucleotide was next deprotected using deblocking mixture and this DMT deprotected dinucleotide was then used for additional cycles in order to generate ASOs having internucleotide thiophosphoramidate or thiophosphate linkages ...
-
No products found
because this supplier's products are not listed.
Nils L. Liebe, et al.,
bioRxiv - Biophysics 2022
Quote:
... For F-actin pre-polymerization ATTO 594-NHS ester (ATTO-TEC, Siegen, Germany) labeled non-muscle G-actin and unlabeled monomers (Cy-toskeleton ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and mice were randomized into treatment groups: (n=7) daily oral gavage of 60 mg kg−1 of eliglustat (AbMole BioScience, M9733) or (n=7 ...
-
No products found
because this supplier's products are not listed.
Alexandros C. Kokotos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... for 30 min and centrifuged at 14,000 rpm for 10 min at 4°C before loading into Monolith NT.115 premium capillaries (NanoTemper). Samples were loaded into the Monolith NT.115 device (NanoTemper ...
-
No products found
because this supplier's products are not listed.
Julie A. Z. Zedler, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 5% Glycerol, 1% protease inhibitor Mix B (SERVA Electrophoresis GmbH, Germany)) and lysed with a Bullet Blender Storm 24 (Next Advance, USA) with 0.15 mm zircodium oxide beads ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pepin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... blood glucose levels were measured after an overnight fasting of 15 hours (± 1 hour) with one drop of blood from the tail-tip using a glucometer (Accu-Chek Aviva Nano).
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Sounak Chowdhury, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by incubation with IVIG (Octagam) (1:100) and pooled human plasma (1:10, Innovative research) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Li Han, et al.,
bioRxiv - Bioengineering 2023
Quote:
The One-step TUNEL In Situ Apoptosis AF 594 Kit (Elabscience) was used ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Rong Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then incubated in primary antibody at 4 °C for 72 hr (1:1,000 chicken anti-GFP, Abcam, ab13970; 1:5000 rabbit anti-fractin, Phosphosolutions, 592-FRAC). Sections were washed several times in TBS ...
-
No products found
because this supplier's products are not listed.
Meiyan Jin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Blots were incubated overnight at 4°C with primary antibodies targeting Tag(CGY)FP (1:2000 dilution in 1% milk, Evrogen, Cat#: AB121), HaloTag (1:1000 dilution in 0.5% milk ...
-
No products found
because this supplier's products are not listed.
Moises Freitas-Andrade, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 10% FBS (Wisent BioProducts, 115727) and 1% penicillin/streptomycin (ThermoFisher ...