-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
John H. Day, et al.,
bioRxiv - Bioengineering 2024
Quote:
... CMs were plated on gelatin for 7 days (Cellular Dynamics) prior to drug treatment and incubated with Dox-containing media for 24 hours prior to fixation and subsequent sample preparation.
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
Larvae (7 dpf) were anesthetized with tricaine and injected with 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ~1.114 particles/ml in PBS) just as for the fluorescent tracer injections ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Ashok Daniel Prabakaran, et al.,
bioRxiv - Physiology 2024
Quote:
... Tissue sections of 5–7 µm thickness of was stained with hematoxylin and eosin (H & E; cat #12013B, 1070C; Newcomer Supply, Middleton, WI). CSA quantitation was conducted on >400 myofibers per tissue per mouse ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 4% chlorhexidine (McKesson Corporation) or 2% acetic acid (Akorn Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Maud de Dieuleveult, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and TET2 (R1086-4; Abiocode). The immunoprecipitated complexes were eluted in Laemmli buffer.
-
No products found
because this supplier's products are not listed.
Concepcion Manzano, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the Basic Fuchsin staining was followed by Calcofluor White (PhytoTechnology laboratories Cat no 4404-43-7) staining for 30 minutes and followed by two washing steps in Clearsee solution ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Silvia J. Park, et al.,
bioRxiv - Neuroscience 2023
Quote:
... eyecups were rinsed twice in PBS and embedded in 7% low-melt agarose (Precisionary, SKU VF-AGT-VM). The agarose-embedded eyecups were Vibratome-sectioned into 100 µm-thick slices (VT1200 ...
-
No products found
because this supplier's products are not listed.
Caleb K. Stubbs, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... after which medium was replaced with fresh medium containing with 7 nM Protective antigen (PA) alone (List Labs, #171E) or in the presence of 3 nM LFNRRSP/ LFNRRSPH4030A and incubated at indicated timepoints at 37°C in the presence of 5% CO2.
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Fabian Stefan Franz Hartmann, et al.,
bioRxiv - Microbiology 2021
Quote:
... Spotting was conducted by setting an overshoot of 1.5 mm and a pin-pressure of 7 % using long 96-well pins (Singer Instruments). To avoid reflection from the plastic edges of the OmnyTray plates as well as effects resulting from the outer barrier of arrayed colonies ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Christina Hipfinger, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Samples were prepared by loading the middle cages of 4×4 LEGO scaffolds with VEGF supplemented GelMA microgels and the supplementary peripheral cages with BMP2 (Shenandoah Biotechnology, Inc.) supplemented with GelMA microgels ...
-
No products found
because this supplier's products are not listed.
Liang Qu, et al.,
bioRxiv - Immunology 2022
Quote:
... and NHP IL-4 ELISpot assay kit (U-CyTech). The cryopreserved rhesus macaques PBMCs were thawed and cultured with pre-warmed AIM-V media ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C20:4 (Nu-Chek Prep, Inc., Elysian, MN) in ethanol each at 100 μM in TSB ...
-
No products found
because this supplier's products are not listed.
P. Stalder, et al.,
bioRxiv - Systems Biology 2023
Quote:
... α-Synuclein purchased from rPeptide (Cat# S-1001-4) was used ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Y. Zhou, et al.,
bioRxiv - Neuroscience 2020
Quote:
... all probes were cleaned by soaking in a solution of 7% detergent (Contrad 70 Liquid Detergent; Decon Labs; King of Prussia, PA) in deionized water followed by rinsing with deionized water.
-
No products found
because this supplier's products are not listed.
Julian M. Jimenez, et al.,
bioRxiv - Bioengineering 2022
Quote:
Homogeneous fibrin gels were prepared to final fibrinogen concentrations of 2 and 4 mg/mL by combining human fibrinogen (FIB3, Enzyme Research Laboratories) and Alexa Fluor (AF ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
Mouse monoclonal antibody specific for Canine Distemper surface envelope antigen (5-4)
Cat# MAB12407-100,
100µg USD $305.35
Ask
Carmen Mirabelli, et al.,
bioRxiv - Microbiology 2021
Quote:
... HNoV GII.4 virus-like particles (VLPs) were purchased from The Native Antigen Company, Poly (I:C ...
-
No products found
because this supplier's products are not listed.
Kelly Snead, et al.,
bioRxiv - Biochemistry 2022
Quote:
... at 4°C using 40µL bed volume (BV) nickel-charged IMAC tips (Biotage, Uppsala, Sweden). The columns were washed in a 96-well deepwell plate with 20BV dH2O and then equilibrated in 20BV of 20mM HEPES pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Jianying Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the cells were incubated at 4°C with goat anti-nucleostemin overnight (1:350, Neuromics, Edina, MN). Then the cells were washed with PBS 3 times and incubated with cyanine 3 (Cy3)-conjugated donkey anti-goat IgG secondary antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Xiuting Liu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and three doses of clodronate-containing liposomes (Liposoma; 200 μL/each on days 4, 11, and 18). Control mice were treated with same doses/volume of IgG (clone HRPN ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
William A. Comrie, et al.,
bioRxiv - Immunology 2019
Quote:
µm in depth with 5.0 µm pores at a density of 4×105 pores/cm2 (Neuro Probe, Inc., Gaithersburg, MD). The filter frame was replaced on the 96-well plate and 25 ul (75,000 cells ...
-
No products found
because this supplier's products are not listed.
Ana Izabel Silva Balbin Villaverde, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... The membrane was blocked (1 h at room temperature) and incubated overnight at 4°C with rabbit polyclonal antibody raised against EL (orb100394, LIPG; Biorbyt) at a dilution of 1:500 in 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Ritesh Tandon, et al.,
bioRxiv - Microbiology 2020
Quote:
... chondroitin sulfate D (CS-D, Mw = 20 kDa) from whale cartilage (Seikagaku, Tokyo, Japan) and chondroitin sulfate E (CS-E ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...