-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Lukas Weiß, et al.,
bioRxiv - Plant Biology 2021
Quote:
... methanol, 0.5 mg/ml X-gluc (1,5-bromo-4-chloro-3-indoxyl-β-D-glucuronic acid, cyclohexylammonium salt (Carbosynth, Bratislava, Slovak Republic), (Schweizer et al. ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Oksana Tsyklauri, et al.,
bioRxiv - Genetics 2020
Quote:
4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Marie-Lynn Al-Hawat, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Sulfo-cyanine 7 carboxylic acid was obtained from Lumiprobe (Cockeysville, MD). IRDye 680RD NHS Ester was obtained from LI-COR Biosciences (Lincoln ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
Thymidine analog
Sold for research purposes only.
Cat# 3419.0, SKU# 3419-50 mg,
50mg, US $55.00 / EA, EURO, €50 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Han Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
No products found
because this supplier's products are not listed.
Valentina Salvi, et al.,
bioRxiv - Immunology 2021
Quote:
... and PE-conjugated anti-IL-4 (clone 7A3-3, Miltenyi Biotec) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Marija Radosevic, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Patarasuda Chaisupa, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Deuterated indole-3-acetic acid (d7-IAA, Cambridge Isotope Laboratories) was used as an internal standard at a concentration of 75 nM in all samples and standards ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Patrick A. Carroll, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-TXNIP (WB and IF, K0204-3, K0205-3, MBL International), anti-PGK1/2 (WB and IF ...
-
No products found
because this supplier's products are not listed.
Alex Rosenberg, L. David Sibley,
bioRxiv - Microbiology 2020
Quote:
... on Cytation 3 (BioTek) multimode plate imager according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Amada M. Abrego, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Rats were induced with 3-4% isoflurane (SomnoSuite, Kent Scientific) and all whiskers on the right facial pad were trimmed except B1 ...
-
No products found
because this supplier's products are not listed.
Kuan-Yi Lu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3% fatty acid-free BSA) was probed to preblocked PIP strips (Echelon Biosciences) and incubated at 4 °C for 16 h ...
-
7-(Diethylamino)-coumarin-3-carboxylic acid (7-DCCA) has been used as a laser dye, fluorescent...
Cat# S5308, SKU# S5308-25mg,
25mg, $97.00
Ask
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 nM GSK2110183 (AKT1/2/3 inhibitor; Selleck Chemicals #S7521), 1 μM AG-490 (JAK2 inhibitor with effects on EGFR kinase ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Charline Ogier, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-TIM3 Ab (4 μg/ml, clone RMT-3-23, BioXCell, Lebanon, NH), or 25-hydroxycholesterol (4 μM ...
-
No products found
because this supplier's products are not listed.
Ashwathi Rajeevan, Riya Keshri, Sachin Kotak,
bioRxiv - Cell Biology 2020
Quote:
Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...