-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 × 105 Huh-7 cells were grown in a 35 mm dish (ibidi) with growth medium ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Prasanna Babu Araveti, et al.,
bioRxiv - Microbiology 2022
Quote:
... the fluorescence images of the HEK293 cells were captured using Axio Observer 7 microscope Apotome 2 (Carl Zeiss).
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ana Lucia Rosales Rosas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
7-Deaza-2’-C-Methyladenosine (7-DMA) was purchased from Carbosynth (Berkshire, UK) and dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
Alexander S. Zhovmer, et al.,
bioRxiv - Biophysics 2023
Quote:
Equimolar mixture of 3-amino-2-fluorobenzotrifluoride (Combi-Blocks, Cat#QA-4188) and 2,6-dichloro-4-isocyanatopyridine (Toronto Research Chemicals, cat#159178-03-7) were stirred and heated in anhydrous Toluene at 85°C overnight ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Heta P. Patel, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and bead beating 7×2 min in a Mini-Beadbeater-96 (Biospec #1001). The lysate was recovered and centrifuged to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Hailey Axemaker, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The spheroids were grown for 21 days and imaged every 7 days with Cytation 3 Imaging reader (Biotek, Winooski, VT, USA). ImageJ software was used to measure the lengths and areas of the spheroids to compare the formed spheroids over time ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Valeria Rudman-Melnick, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Francois Chesnais, et al.,
bioRxiv - Bioengineering 2022
Quote:
... plates up to passage 7 and maintained in Endothelial Growth Medium 2 (EGM2; Promocell). Normal Human Dermal Fibroblasts (NHDF ...
-
No products found
because this supplier's products are not listed.
Sahil Nagpal, et al.,
bioRxiv - Biophysics 2023
Quote:
U-2 OS and COS-7 cells were obtained from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Sinan Arslan, et al.,
bioRxiv - Genomics 2022
Quote:
... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Lisha Zha, et al.,
bioRxiv - Immunology 2021
Quote:
... HIV-1 PSD and pCMV3 containing the SARS-CoV-2/COVID-19 Spike gene were co-transfected into 7 x 105 293F cells using Sinofection (Sino Biological, Beijing, China). The medium was replaced with fresh DMEM containing 10% FBS after overnight incubation ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Hiroaki Kaku, Thomas L. Rothstein,
bioRxiv - Cell Biology 2019
Quote:
... after which cells were resuspended in 2 μg/ml 7-aminoactinomycin D (7-AAD) (Anaspec). Cell viability was assessed using Gallios (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Rinaldo D. D’Souza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... into one of ten cortical areas and performing iontophoretic injections (3 µA, 7 s on/off cycle for 7 minutes; Midgard current source; Stoelting) of biotinylated dextran amine (BDA ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Tommaso Zeppillo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM 6-cyano-7-nitroquinoxaline-2,3-dione (NBQX, Hello Bio, Bristol, UK) and 2 μM (R)-3-(2-Carboxypiperazin-4-yl)-propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Mathilde Bergamelli, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Immunostainings were performed with the following antibodies: rabbit anti-Cytokeratin-7 (Genetex; 2 μg/mL), mouse anti-Vimentin (Santa-Cruz ...
-
6-Bromo-2-hydroxy-3-methoxybenzaldehyde is a bromobenzaldehyde derivative that participates in...
Cat# S6495, SKU# S6495-25mg,
25mg, $97.00
Ask
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 nM GSK2110183 (AKT1/2/3 inhibitor; Selleck Chemicals #S7521), 1 μM AG-490 (JAK2 inhibitor with effects on EGFR kinase ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
Thymidine analog
Sold for research purposes only.
Cat# 3419.0, SKU# 3419-50 mg,
50mg, US $55.00 / EA, EURO, €50 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Omar A. Saldarriaga, et al.,
bioRxiv - Pathology 2019
Quote:
... 7-color manual IHC kit (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Josephine Bock, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...