-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Lacey A Perdue, et al.,
bioRxiv - Bioengineering 2020
Quote:
... poly(ethylene glycol) methyl ether azide (20 kDa, Nanocs). Polyacrylamide gels (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Yanwen Fu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.3% Hydroxypropyl Methyl Cellulose (HPMC) (cat# H1335, Spectrum Chemical), pH 5.8).
-
No products found
because this supplier's products are not listed.
Stephanie Bruggink, et al.,
bioRxiv - Physiology 2021
Quote:
... A female luer (Figure 1H thread style to 500 series barb 1/16 inch ID tubing Cole-Parmer Instrument #SK-45508-01 connected to tubing Picture 1B Silastic Laboratory Tubing #508-005 ...
-
No products found
because this supplier's products are not listed.
Patrícia Dias Carvalho, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... After one wash in 1% bovine serum albumin (BSA; NZYtech) in PBS 1x ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
E. Bayart, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Immunostaining was performed by incubating membrane 1h at room temperature with 1/1000 diluted of rabbit polyclonal anti-Poly-ADP Ribose (TREVIGEN 4336-BPC-100), rabbit monoclonal anti-PARP1 (Cell Signaling Technology CST#9532 ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Kai Qiao, Lydia M. Le Page, Myriam M. Chaumeil,
bioRxiv - Biochemistry 2020
Quote:
... prepared as previously described25) was polarized for 1h on a Hypersense dDNP polarizer (Oxford Instruments), then dissolved in 4.5mL or 3.5mL buffer (pyruvate buffer ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
No products found
because this supplier's products are not listed.
Ghanshyam P. Sinha, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sucrose-aCSF from one lateral side to the other side using a vibrating microtome (7000smz-2; Campden Instruments, Lafayette, IN, USA). All slices were incubated for 15 min at room temperature in recovery solution that contained (in mM) ...
-
No products found
because this supplier's products are not listed.
James W. Smyth, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and twice with PBS (2 x 5 min) before using One-step TUNEL In Situ Apoptosis kit (Green Elab Fluor® 488; Elabscience), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dóra Tombácz, et al.,
bioRxiv - Genomics 2020
Quote:
... and strand-switching oligonucleotides with three O-methyl-guanine RNA bases (PCR_Sw_mod_3G; Bio Basic, Canada). The resulting double-stranded cDNAs were amplified by PCR using KAPA HiFi DNA Polymerase (Kapa Biosystems) ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Cristóbal Gallegos, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Sequencing was performed in two batches, one by GenomeQuébec (Montréal, Canada) and one by GENEWIZ (Suzhou, China). Both batches used one lane of Illumina HiSeq 4000 (paired-end ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
Emily E Whittle, et al.,
bioRxiv - Microbiology 2021
Quote:
... One assay used MOPs minimal media (Teknova) which was supplemented with 400 mg/L histidine.
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5311-1GM,
1 gram, USD $305.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Michael Morgan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... We added 29 µM of the enzyme:peptide mixture to 1 mL of 30 µM Ub-AMC (7-amino-4- methylcoumarin) (Boston Biochem), for a final concentration of 200 nM DUBm ...
-
No products found
because this supplier's products are not listed.
Govind Nair, et al.,
bioRxiv - Bioengineering 2024
Quote:
... via vortexing for one minute (IKA MS3 Vortexer) and spun down for one minute (MyFuge C1012 ...
-
No products found
because this supplier's products are not listed.
Raj Kumar Sadhu, et al.,
bioRxiv - Biophysics 2022
Quote:
... Flash Red polystyrene beads (Bangs Laboratories Inc., 7 µm diameter) were washed three times in sterile PBS and opsonized overnight at 4°C in 3 mg/mL mouse IgG (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Biswarathan Ramani, et al.,
bioRxiv - Genomics 2023
Quote:
... 2: rabbit anti-tRFP (1:1,000 dilution, polyclonal, Evrogen, AB233). The following secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Laura R Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 5 mL of 1/2 MS with 2% low melt agarose was cast into imaging cuvettes (CellVis product number #C1-1.5H-N) after being filtered through a 0.45 micron nylon filter to remove any particulates that might disturb the path of the light sheet to prepare media “blankets” ...
-
No products found
because this supplier's products are not listed.
Peter J. Bosch, et al.,
bioRxiv - Neuroscience 2023
Quote:
... received bilateral injections with control virus into one hemisphere and α-Synuclein overexpression into the other hemisphere: Control: AAV6-CAG-mCherry-WPRE (1.7×1012 gc/mL, Vector Biolabs, 1 μL, left hemisphere) and overexpression ...
-
No products found
because this supplier's products are not listed.
Daniyal J Jafree, et al.,
bioRxiv - Pathology 2024
Quote:
... mouse monoclonal anti-platelet and endothelial cell adhesion molecule 1 (PECAM1/CD31 Aligent, GA610, clone: JC70A, 1:50) rabbit polyclonal anti-ssu-2 homolog (SSUH2, Atlas Antibodies, HPA049777, 1:100), rabbit polyclonal anti-fibulin 2 (FBLN2 ...
-
No products found
because this supplier's products are not listed.
Irini Topalidou, et al.,
bioRxiv - Cell Biology 2019
Quote:
Approximately 1-2 × 105 cells per well were plated onto cover slips (Thomas Scientific #121N79) placed in 24-well cell culture plates ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Daniel Egert, et al.,
bioRxiv - Bioengineering 2020
Quote:
... blocked and incubated for 7-10 days at room temperature with both primary antibodies Rb ∝ mOR (ImmunoStar 24216) and Ms ∝ NeuN (Millipore MAB377) ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Oyahida Khatun, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were induced for 1 hour with 1000U/ml universal Type I interferon (IFN) (11200-2, PBL Assay Science). Similarly ...
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 M (MyBioSource, MBS8574735) and SARS-CoV-2 E (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for either 24 h or 7 days in medium containing one or a combination of the following reagents: DMSO (Bioshop Canada, DMS666), Doxorubicin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
José Miguel Arcas, et al.,
bioRxiv - Neuroscience 2024
Quote:
... of 1% RAP in one eye or vehicle (8% ethanol, 2% Cremophor in saline) in the other using a graduated micropipette (Gilson Pipetman P2). Each solution was applied for 2 minutes ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
No products found
because this supplier's products are not listed.
Ophir Vermesh, et al.,
bioRxiv - Bioengineering 2021
Quote:
Six one-liter chambers (Braintree Scientific, Braintree, MA) were operated in parallel for simultaneous mouse limonene measurements (Fig ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Joana F. da Rocha, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μL of 1:10 diluted cDNA was added to 10 μL of 2× SYBR® Green Supermix (Bimake, Houston, Texas, USA) and the final concentration of each primer was 250 nM in 20 μL of total volume ...
-
No products found
because this supplier's products are not listed.
Trevor M Nolan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... plated on 1/2 Linsmaier and Skoog (LSP03-1LT, Caisson Labs; pH 5.7), 1% sucrose media ...