-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
Ashok Daniel Prabakaran, et al.,
bioRxiv - Physiology 2024
Quote:
... Tissue sections of 5–7 µm thickness of was stained with hematoxylin and eosin (H & E; cat #12013B, 1070C; Newcomer Supply, Middleton, WI). CSA quantitation was conducted on >400 myofibers per tissue per mouse ...
-
No products found
because this supplier's products are not listed.
Conner J. Rogan, et al.,
bioRxiv - Plant Biology 2023
Quote:
... After adding 20 µL of N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (CovaChem), the sample was incubated at 37°C and shaken at 1800 rpm for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
John H. Day, et al.,
bioRxiv - Bioengineering 2024
Quote:
... CMs were plated on gelatin for 7 days (Cellular Dynamics) prior to drug treatment and incubated with Dox-containing media for 24 hours prior to fixation and subsequent sample preparation.
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Expanded gels were transferred into 50×7 mm glass bottom dishes (WillCo Wells) for imaging ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Fabian Stefan Franz Hartmann, et al.,
bioRxiv - Microbiology 2021
Quote:
... Spotting was conducted by setting an overshoot of 1.5 mm and a pin-pressure of 7 % using long 96-well pins (Singer Instruments). To avoid reflection from the plastic edges of the OmnyTray plates as well as effects resulting from the outer barrier of arrayed colonies ...
-
No products found
because this supplier's products are not listed.
Mahmoud M. Elguindy, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Chromosome enumeration probes for chromosome 7 (CHR7-10-GR) and chromosome 20 (CHR20-10-RE) were purchased from Empire Genomics. Cells were trypsinized ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Léa Torcq, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Samples were then centrifugated for 7 min at 300g to remove the TrypLE and the cells were resuspended in 500µl FACSmax medium (Genlantis ref#T200100). Ultimately ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV 3CLpro complex with compound 5: Berkeley screen (Rigaku Reagents) condition B1 (30% (w/v ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Sujatha Muralidharan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A normal tissue TMA consisting of different organ specimens from 3 unique individuals was sourced from US Biomax (Cat# FDA999w1).
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were switched to DMEM supplemented with 5% fetal bovine lipoprotein deficient serum (Alpha Diagnostic International), 100 U/ml penicillin and 100 μg/ml streptomycin ...
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...