-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Yang Chen, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... at 37°C for 20 minutes and developed for 3∼5 minutes at room temperature in the dark with freshly prepared DAB solution (Boster). The slides were observed under a microscope.
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
Larvae (7 dpf) were anesthetized with tricaine and injected with 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ~1.114 particles/ml in PBS) just as for the fluorescent tracer injections ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Changuk Chung, et al.,
bioRxiv - Neuroscience 2023
Quote:
... pellets were resuspended in 5 ml NF1 buffer and Dounce homogenized 5x in a 7 ml Wheaton Dounce Tissue Grinder (DWK Life Sciences) using a ‘loose’ pestle ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... Endothelium-intact or -denuded rings were mounted on tungsten wires and immersed in PSS at 37°C with constant gassing (21% O2 and 5% CO2) in a wire myography chamber (DMT 610) and incubated ex vivo with oxLDL (50μg/dL; 2h; Kalen Biomedical, cat. no. 770202-7), followed by normalization and KCL (100mM ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Yi-Cheng Chang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The full coding sequence of Nr6a1 long isoform was synthesised with Notl restriction enzyme site addition at the 5’ and 3’ ends by Biomatik, USA ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
Cat# 127028-21-1,
Inquire
Ask
Micah Y. Belew, et al.,
bioRxiv - Neuroscience 2023
Quote:
Nicotinamide Riboside (NR) (BOC sciences cas no 1341-23-7) was supplemented as described in (35) ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
Magnetofection
diificult to transfect cells
Cat# KC30400,
SilenceMag 200µL + PolyMag 100µL + PolyMag Neo 100µL+ CombiMag 100µL + Magnetic plate MF10000, USD $798.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Nuria Tubau-Juni, et al.,
bioRxiv - Immunology 2019
Quote:
... plates supplemented with 7% of Horse laked blood (Lampire Biological Laboratories, Pipersville, PA) and H ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Kathryn M. Polkoff, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and immunostaining occurred over 7 days with anti-GFP primary antibody (Aves Labs, GFP-1010), and Cy3 donkey anti-Chicken IgG (Jackson ImmunoResearch Labs ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H5,
1.0 ea, USD $1915.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Avery Rui Sun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SB-431542 (5 µM, Targetmol). All cells used in the in vitro sample reseeding studies were from passages 2 or 3 ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Caleb K. Stubbs, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... after which medium was replaced with fresh medium containing with 7 nM Protective antigen (PA) alone (List Labs, #171E) or in the presence of 3 nM LFNRRSP/ LFNRRSPH4030A and incubated at indicated timepoints at 37°C in the presence of 5% CO2.
-
No products found
because this supplier's products are not listed.
Liliana D Ordonez, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-K18 (1/5; Progen Biotechnik), anti-ΔNp63 (1:100 ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...