-
Cat# HY-N1993-5 mg,
5 mg, USD $50.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Martijn Cordes, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng/ml human IL-7 (Miltenyi Biotec), and 5 ng/ml human FLT3L (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Tarjani M. Thaker, et al.,
bioRxiv - Biophysics 2021
Quote:
... double-Cysteine mutants generated on the C-less background of BmrCD were eluted following Ni-NTA purification and labeled with 20-fold molar excess of 1-oxyl-2,2,5,5-tetramethylpyrroline-3-methyl methanethiosulfonate (Enzo Life Sciences) at room temperature in the dark over a 4 h period ...
-
No products found
because this supplier's products are not listed.
Wouter Huiting, et al.,
bioRxiv - Genetics 2021
Quote:
... homogenized by 5-7 20s cycles with a FastPrep-24 (MP Biomedicals) at 4 m/s ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Methyl Methacrylate/Butyl Methacrylate (Electron Microscopy Sciences, Cat ...
-
No products found
because this supplier's products are not listed.
Damián Balfagón, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and N-Methyl-N-(trimethylsilyl)trifluoroacetamide (Macherey-Nagel). Fatty acid methyl esters (C8-C24 ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Okada, et al.,
bioRxiv - Genomics 2024
Quote:
Pico Methyl-Seq Library Prep Kit (Zymo research) was used for making WGBS libraries basically as manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Takeshi Hiramoto, et al.,
bioRxiv - Neuroscience 2021
Quote:
... nadic methyl anhydride (NMA, Polysciences Inc., cat# 00886–500), and 2,4,6-Tris-(dimethylaminomethyl)phenol (DMP- 30 ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Z-RLRGG-7-amino-4-methyl-courmarin (peptide-AMC) was purchased from Bachem. Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tris(3-hydroxypropyltriazolyl-methyl)amine (THPTA) was purchased from Click Chemistry Tools. 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... [[[(1S)-1-(4-Bromophenyl)ethyl]amino](1,2,3,4-tetrahydro-2,3-dioxo-5-quinoxalinyl)methyl] phosphonic acid tetrasodium salt (PEAQX; HelloBio).
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Cynthia M. Arokiaraj, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Cyanine 3 and Cyanine 5 reagents from Akoya Biosciences at 1:1500 ...
-
No products found
because this supplier's products are not listed.
Vipin Rawat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... After 5-7 days cells were counted using a Z1 Coulter Particle Counter (Beckman Coulter).
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Jessica M Snyder, et al.,
bioRxiv - Pathology 2020
Quote:
... 7 Cyp26b1−/− (3M, 4F), and 6 Cyp26b1+/− (3M ...
-
No products found
because this supplier's products are not listed.
Filippo Macchi, Eric Edsinger, Kirsten C. Sadler,
bioRxiv - Genomics 2022
Quote:
... or anti-5-methyl-cytosine (5mC – Aviva Biosystem clone 33D3 ...
-
No products found
because this supplier's products are not listed.
V. E. Dunlock, et al.,
bioRxiv - Immunology 2019
Quote:
... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
No products found
because this supplier's products are not listed.
Taotao Sheng, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Adapter-ligated DNA was subjected to immunoprecipitation with a primary monoclonal antibody against 5-methyl cytosine (Diagenode C15200081) using a previously published protocol [71] ...
-
No products found
because this supplier's products are not listed.
Marcin Poreba, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Fluorescent tags (Cyanine-5 NHS and Cyanine-7 NHS) were purchased from Lumiprobe (Hannover, Germany). Diazomethane was generated according to the Aldrich Technical Bulletin (AL-180 ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
Shuntaro Morikawa, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Fluorescence for cell viability and luminescence for caspase-3/7 activity was measured using Infinite M1000 plate reader (Tecan). Caspase-3/7 activity was normalized to cell viability according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Sujung Choi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... -H3K27 di-and tri-methyl (H3K27me2/3, Active Motif, cat # 39538), -nuclear pore glycoprotein p62 (NUP62 ...
-
5-Methyl-7-methoxyisoflavone is a chemical compound commonly used as a bodybuilding supplement.
Cat# S9139, SKU# S9139-25mg,
25mg, $107.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Takushi Shimomura, et al.,
bioRxiv - Biophysics 2022
Quote:
In PI(3, 5)P2-injection experiments, 5 mM PI(3, 5)P2–diC8 (Echelon Biosciences) was manually injected by positive pressure using the glass needle filled with the PI(3 ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2022
Quote:
... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
No products found
because this supplier's products are not listed.
Peyton J. Spreacker, et al.,
bioRxiv - Biophysics 2022
Quote:
... and 70 mg/L sodium α-ketobutyrate (2H-3, 13C-methyl; Cambridge Isotope Laboratories, Tewksbury, MA). EmrE was purified also as previously reported (8 ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Hailing Zong, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 70 µl of cells at 5-7×105 cells/ml were seeded into a Culture-Insert 2 Well (ibidi) and grown to confluency ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Ichia Chen, et al.,
bioRxiv - Biophysics 2020
Quote:
... 5 mM Na-Asp and 7 mM n-decyl-β-D-maltopyranoside (C10M; Anatrace). For GltPh-XL2 and GltPh-XL3 ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ana Lucia Rosales Rosas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
7-Deaza-2’-C-Methyladenosine (7-DMA) was purchased from Carbosynth (Berkshire, UK) and dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
Ankit Tanwar, Pamela Stanley,
bioRxiv - Immunology 2022
Quote:
... ∼3-5×107 thymocytes were incubated with 20 μg anti-CD4 (rat IgG2b clone GK1.5, BioXCell) and 37.5 μg anti-CD8a (rat IgG2a clone 53-6.72 ...
-
No products found
because this supplier's products are not listed.
Maria Chechik, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The most concentrated fraction was spun for 5 min at 13K rpm before applying 3 µL to UltraAuFoil R1.2/1.3 gold support grids (Quantifoil). Prior to sample applications grids were glow-discharged for 3 min in Pelco easiGlow glow-discharger (Pelco ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...