-
No products found
because this supplier's products are not listed.
Lisa B. Fridman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 7-benzyloxy-4-trifluoromethylcoumarin (BFC, Sigma), for 90 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Naveen Thakur, et al.,
bioRxiv - Biophysics 2023
Quote:
... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
No products found
because this supplier's products are not listed.
Gouranga Saha, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... α-methyl-5-hydroxytryptamine (500 μg; Abcam), and endothelin-1 (10 pmol ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Patrick C. Kerstein, et al.,
bioRxiv - Neuroscience 2020
Quote:
... (S)-1-(2-Amino-2-carboxyethyl)-3-(2-carboxy-5-phenylthiophene-3-yl-methyl)-5-methylpyrimidine-2,4-dione (ACET; 1μM; Tocris Bioscience, catalog #2728).
-
No products found
because this supplier's products are not listed.
Jonathan So, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 mM of IncuCyte Caspase-3/7 Green Apoptosis Assay Reagent (Sartorius, cat #4440) as well as 1:500 of Nuclight Rapid Red Dye (Sartorius ...
-
No products found
because this supplier's products are not listed.
Mitchell G. Kluesner, et al.,
bioRxiv - Bioengineering 2020
Quote:
... IL-7 (5 ng/mL, PeproTech), and IL-15 (5 ng/mL ...
-
No products found
because this supplier's products are not listed.
Aashiq H. Mirza, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... USA (Catalog No. S3190) and 7-Methyl-guanosine-5’-monophosphate (m7GMP) was purchased from Jena Bioscience, Jena ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jose A. Valverde-Lopez, et al.,
bioRxiv - Developmental Biology 2023
Quote:
FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
No products found
because this supplier's products are not listed.
Huiru Sun, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... WCLs were incubated with 50 μl 7-methyl-GTP Sepharose 4B beads (GE Healthcare) for 2 h at 4 °C ...
-
No products found
because this supplier's products are not listed.
Yi-Wei Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
COS-7 cells (∼ 3-5 x 104) were grown on 8-well chamber glass slides (BD Falcon 8 chamber tissue culture-treated glass slides ...
-
No products found
because this supplier's products are not listed.
Adam J. Sugarman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... folic acid and 5-methyl-THF (Cayman Chemical).
-
No products found
because this supplier's products are not listed.
Kazuki Yoshizumi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... and 5 μl 7-AAD (Biolegend) were added ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Masayo Omura, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-methyl-2,4-nonanedione was purchased from Santa Cruz Biotechnology and Combi-Blocks.
-
No products found
because this supplier's products are not listed.
Reeku Chaudhary, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
No products found
because this supplier's products are not listed.
Siyi Bai, et al.,
bioRxiv - Immunology 2023
Quote:
... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Shan Qi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 µM [methyl-3H] S-adenosyl methionine (PerkinElmer), 10 µM substrate RNA/DNA probe ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Nicole G. Bender, et al.,
bioRxiv - Immunology 2020
Quote:
... female outbred CD1 mice (N=5) aged 5-7 weeks (Charles River) were immunized with 20 μg of either wheat germ cell-free expressed UF1 ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Franziska Blaeschke, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng/ml IL-7 (R&D Systems), 5 ng/ml IL-15 (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... IL-7 (5 ng/mL) (Stemcell Technologies, Cat.#78053), IL-15 (5 ng/mL ...
-
No products found
because this supplier's products are not listed.
Justin A. Peruzzi, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Cyanine 7) (Cy 7 PE) were purchased from Avanti Polar Lipids. 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl ...
-
No products found
because this supplier's products are not listed.
Alexandra A. Vetrova, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Sections (5-7 μm thick) were cut using Reichert-Jung (Leica) Ultra-cut 701701 ultramicrotome (Reichert-Jung ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Bethany A Stahl, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Embryos were mounted in 3% hydroxypropyl methyl cellulose (VWR, cat# 200012-722) in E3 medium (ref) ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-cyano-7-ethoxycoumarin (CEC, 30 μM; Cyp1a2; Cat. No. 451014. Corning Inc.), coumarin (CM ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Zachary H. Walsh, et al.,
bioRxiv - Immunology 2023
Quote:
... with substitution of N-1-methyl-pseudouridine-5’-triphosphate (TriLink Biotechnologies, #N-1081-1) for UTP and co-transcriptional capping with CleanCap® Reagent AG (TriLink Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Julia Fadjukov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Patch pipettes (5–7 MΩ, BF120-69-10, Sutter Instruments) were filled with an intracellular solution composed of (in mM) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Andreane Cartier, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... counterstained with methyl green (Vector Laboratories). Brightfield images were taken using Zeiss Axioskop2 microscope with an AxioCam digital camera (Zeiss) ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Beyza Büyükurgancı, et al.,
bioRxiv - Biophysics 2023
Quote:
Methyl cellulose (MC, 4000 cPs, Alfa Aesar 036718.22, CAS# 9004-67-5) and phosphate buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Kathrin S. Jutzeler, et al.,
bioRxiv - Microbiology 2024
Quote:
... We infected 5 female BALB/c and 5 female C57BL/6 mice (Envigo, 7-9 weeks old) per parasite population with 50 cercariae via tail immersion [26] ...
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... After 5-7 days of expansion with BEGM media (Lonza #CC-3170), air-liquid interface (ALI ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).