-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
No products found
because this supplier's products are not listed.
Yulong Wei, et al.,
bioRxiv - Bioengineering 2021
Quote:
Young (1-2 weeks old) bovine knee joints were obtained from Vendors (Lampire biological laboratories), and cartilage explants were harvested from the trochlear groove using biopsy punch and cultured with chemically defined medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Angela Ma, et al.,
bioRxiv - Microbiology 2022
Quote:
... DFA kits were used to test for herpes simplex virus types 1 and 2 (D3 DFA HSV Identification and Typing kit, Quidel, San Diego, CA), varicella-zoster virus (Light Diagnostics ...
-
No products found
because this supplier's products are not listed.
Mustapha Dibbasey, Terry Gaymes,
bioRxiv - Cancer Biology 2021
Quote:
... Both HR plasmids (dl-1 and dl-2) and positive control plasmid were supplied with the Norgen’s Homologous Recombination kit (Norgen Biotek Corp., Thorold, ON, Canada). For each transfection ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Kaamini M. Dhanabalan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 50:50 and 65:35) of different molecular weights from 10,000 - 85,000 Da having carboxylic acid end groups were purchased from Akina (AP041) (West Lafayette ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Paule Dagenais, et al.,
bioRxiv - Biophysics 2021
Quote:
... excisions of rays were conducted using a micro dissecting knife (RS-6220, dean knife 5” 1 mm x 7 mm blade curved, Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Chao Wu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 30 pmol of protein in 50 μL of 1:1 solvent mixture of acetonitrile:water with 0.1% formic acid (CovaChem) was loaded onto a C8 trap (ZORBAX Eclipse XDB C8 column ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Min-Ting Lee, Henry H. Le, Elizabeth L. Johnson,
bioRxiv - Microbiology 2020
Quote:
... The residual bacterial pellets were homogenized in a 2 mL microtube containing 1 mm zirconium beads (OPS diagnostics, NJ) and 500 μL of PBS for 3 min using a mini-BeadBeater (BioSpec products ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Kevin R. Theis, et al.,
bioRxiv - Microbiology 2019
Quote:
... placed into a sterilized Wheaton dounce reservoir (2 ml or 5 ml; DWK Life Sciences, Millville, NJ) containing 1 ml of sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
In-Hyuk Jung, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 µg ml-1 human medium oxidized low density lipoprotein (oxLDL, #770202-7, Kalen biomedical) was used.
-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Brandon Drescher, et al.,
bioRxiv - Neuroscience 2024
Quote:
Blocks were trimmed to a hexagonal block face approximately 1 × 2 mm with a 45° diamond trimming knife (DiATOME, Hatfield, PA) followed by imaging in a Zeiss Xradia 520 Versa 3D X-ray microscope (Carl Zeiss Microscopy LLC ...
-
No products found
because this supplier's products are not listed.
Brittany G. Seman, et al.,
bioRxiv - Immunology 2019
Quote:
... the culture was supplemented with 100 units of interleukin-2 (IL-2; Shenandoah Biotech, Warwick, PA) or 3×105 CD3/CD28 Dynabeads/well (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Malwina Brożyna, et al.,
bioRxiv - Microbiology 2023
Quote:
... Firstly, 1 mL of 2% (w/v) Bacteriological Lab Agar (Biomaxima, Poland) was poured into a 24-well plate (Wuxi Nest Biotechnology, China) and left for solidification ...
-
No products found
because this supplier's products are not listed.
Victoria G. Weis, et al.,
bioRxiv - Bioengineering 2023
Quote:
... animals were administered loperamide hydrochloride (Medline, Northfield, IL, USA) at 10 mg/kg diluted in sterile water via oral gavage to inhibit intestinal peristalsis or vehicle control (sterile water ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Tina Pekec, et al.,
bioRxiv - Physiology 2021
Quote:
... then 5 μM FeRhoNox™-1 solution (Goryo Chemical, Inc., Sapporo, Japan) was added and incubated in the dark at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Linlin Yang, et al.,
bioRxiv - Immunology 2020
Quote:
Transgenic larvae were injected at 3 dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa ...
-
No products found
because this supplier's products are not listed.
Gabriela Krejčová, et al.,
bioRxiv - Immunology 2021
Quote:
... 2 g/L sodium bicarbonate (J&K Scientific), 10% FBS (Biosera ...
-
No products found
because this supplier's products are not listed.
Prakash Thapa, et al.,
bioRxiv - Immunology 2019
Quote:
... with 2% human serum (Valley Biomedical Products & Services) with 800 U/mL granulocytemacrophage colony-stimulating factor (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... and 5-μm sections were cut and stained with hematoxylin and eosin (H&E) or acid-fast stain (Diagnostic BioSystems). A boarded veterinary pathologist performed a masked evaluation of lung sections for inflammation using a scoring system ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-SARS-CoV-2 seropositive human serum samples (convalescent) were obtained from BioIVT. BioIVT sought informed consent from each subject ...
-
No products found
because this supplier's products are not listed.
Francisco J. Cao-Garcia, et al.,
bioRxiv - Biophysics 2023
Quote:
... After HaloTag ligand functionalization the fluid chambers were passivated for at least 3 h with blocking buffer containing 1% w/v sulfydryl-blocked BSA (Lee Biosolutions) in 20 mM Tris-HCl pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Quentin Defenouillere, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The 2-NBDG signal was visualized using a GFP filter set (41020 from Chroma Technology, Bellows Falls ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Isabella M. Fuentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mice were singly confined to a sheet of filter paper (11 × 5 × 3.5 cm) for 1 hour using an inverted Micro-Isolator cage bottom (Lab Products, Seaford, DE). At the end of the testing period ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Federico Brandalise, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TTX (1 µM; Latoxan), 4AP (100 µM ...
-
No products found
because this supplier's products are not listed.
Niklas Schandry, et al.,
bioRxiv - Plant Biology 2021
Quote:
Individual isolates were pre-cultured in ½ strength TSB medium in 96-Well 2 ml deep-well plates (Semadeni) covered with a Breathe-Easy (Diversified Biotech) membrane until stationary phase for 6 d at 28°C and 180 rpm ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...