-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Daniel M. Foulkes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Compounds A (2-[(3-chlorophenyl)amino]-4,6-dimethylnicotinamide) and B 2-[(2,5-dichlorophenyl)amino]-4,6-dimethylnicotinamide were purchased from ChemBridge. Arylsulfonamide 1 was purchased from MolPort ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Leena Putzeys, et al.,
bioRxiv - Microbiology 2022
Quote:
... 0.5% casein amino acids (LabM, Neogen), 2 mM MgSO4 ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Vineet Choudhary, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an amino acid mix (United States Biologicals), containing either 2% glucose ...
-
No products found
because this supplier's products are not listed.
Platre Matthieu Pierre, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The pellet was resuspended in 1 mL of immunoprecipitation buffer (50 mM Tris at pH 8, 150 mM NaCl, 1% Triton X-100) using a 2-mL potter (Wheaton), and was left on a rotating wheel for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Michael Morgan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... We added 29 µM of the enzyme:peptide mixture to 1 mL of 30 µM Ub-AMC (7-amino-4- methylcoumarin) (Boston Biochem), for a final concentration of 200 nM DUBm ...
-
No products found
because this supplier's products are not listed.
Taylor Boggess, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pregnant females were given free access to a once daily 1ml solution of 1:1 condensed milk/water containing either pharmaceutical grade buprenorphine hydrochloride (CIII) (5 mg/kg; Spectrum Chemical, Gardena, CA), gabapentin (30 mg/kg ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
No products found
because this supplier's products are not listed.
Michael Riffle, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Desalting was performed with 8 μL of 0.1% formic acid plus 2% acetonitrile and the trap was subsequently brought online with a Self-Packed PicoFrit Column (New Objective part number PF360-75-10-N-5 ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Jasmine M Manouchehri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The concentrations of sulfatase 1 and 2 (Lifespan Biosciences, Cat# LS-F66757-1 and LS-F35926-1) were measured in the supernatants of the examined cell lines at basal level via enzyme-linked immunoassay (ELISA ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
No products found
because this supplier's products are not listed.
Bhagyashree Deshmukh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 2 mM PMSF) at parameters of 3 sec ON/ 5 sec OFF/ 60% amplitude (Probe sonicator Thomas Scientific). The supernatant was separated by spinning at 12,000 RPM ...
-
No products found
because this supplier's products are not listed.
Dmitri Dormeshkin, et al.,
bioRxiv - Immunology 2022
Quote:
... The membrane was washed and then incubated with 1:5 000 SARS-COV-2 Spike RBD Polyclonal Antibody antibodies (#E-AB-V1006, Elabscience) for 1 h at RT and with 1:10 000 Goat Anti-Rabbit-HRP (#31460 ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slices were in the chamber for 30 min with sucrose-based ACSF at 1-2 mL/min (#Minpuls 2, Gilson) and then NaCl-based ACSF (125 mM NaCl instead of sucrose ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
Glycosil® is a thiol-modified hyaluronic acid. Glycosil® hyaluronic acid is a component of the...
Cat# GS222F-5EA,
1 mL, USD $265.0
Ask
Samuel S. Hinman, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were coated with 2 mL of 10 µg mL-1 human type 1 collagen (5007, Advanced Biomatrix) in 1× PBS (46-013-CM ...
-
No products found
because this supplier's products are not listed.
Emily Breeze, et al.,
bioRxiv - Plant Biology 2020
Quote:
Infected leaf samples were removed by razor blade and mounted upright onto a cryo-sledge coated using a 1:1 mix of OCT compound / colloidal graphite and rapidly frozen in liquid nitrogen slush (Alto 2100 cryo system, Gatan, Ametek, Leicester, UK). The frozen samples were then transferred under vacuum into the cryo-pre-chamber ...
-
No products found
because this supplier's products are not listed.
J. Z. Alex Cheong, et al.,
bioRxiv - Microbiology 2021
Quote:
... with 0.2 g of 1 mm sterile glass beads for 10 min at full-speed on a Vortex-Genie 2 (Scientific Industries, Bohemia, NY) before serial dilution and spot plating 20 μL on TSA plates with no antibiotic supplementation.
-
No products found
because this supplier's products are not listed.
Huy Pho, et al.,
bioRxiv - Physiology 2020
Quote:
... and ~125μL bilateral viral injections of either Ad-LepRb (ADV-263380, Vector Biosystems, 2-5×1010 PFU/mL) or Ad-mCherry (Cat No: 1767, Vector Biolabs, 1×1010 PFU/mL) were performed using −1.88 mm caudal ...
-
No products found
because this supplier's products are not listed.
Xiao He, Yunlu Kang, Lei Chen,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM EGTA and 1 mM PMSF) with a disperser (IKA T18 digital ULTRA-TURRAX). The crude lysis was ultracentrifugated at 35 ...
-
No products found
because this supplier's products are not listed.
Subbaiah Chalivendra, et al.,
bioRxiv - Plant Biology 2020
Quote:
... of the seed meal were extracted with 25 mL 1:1 acetonitrile/water for 2 h on a Model G2 Gyrotory Shaker (New Brunswick Scientific, Edison, NJ, USA). Extracts were filtered with a Whatman 125 mm 2V paper filter (GE Healthcare Bio-Sciences ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Jae Won Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 3-oxo-DCA were purchased from Steraloids (Newport, RI, USA). Isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Boshi Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Doxorubicin hydrochloride (Tebu-bio, BIA-D1202-1) was dissolved in sterile milliQ water at 250 μM as stock ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F1,
1.0 ea, USD $390.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Johannes Yayo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Waters amino acid standard solution with 17 amino acids (cat. no. WAT088122) was mixed with glutamine (Irvine Scientific, Tilburg, The Netherlands), asparagine ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2020
Quote:
... via tubing connected to the bottom of each chamber (3.17 mm ID tubing Ismatec SC0222-LT 2-Stop 0; Masterflex SC0223-LT Tygon; Masterflex Hose Barb Union 1/8”, Cole-Parmer Instrument Company LLC. ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Xianyao Zheng, et al.,
bioRxiv - Biochemistry 2023
Quote:
Analysis of Amino acids: A TSKgel Amide-80 HILIC column (250 mm × 2.0 mm, 5 µm, Tosoh Bioscience LLC) was used at column temperature 30°C ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Ujjayini Ghosh, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and then incubated with 20 µl of a 1 mM solution of azide-PEG-maleimide and azide-PEG-methoxyl (5 and 2 kDa molecular weight, respectively, Nanocs) at a 1:9 ratio for 6 hours ...
-
No products found
because this supplier's products are not listed.
Amanda Bentley-DeSousa, Michael Downey,
bioRxiv - Molecular Biology 2021
Quote:
... supplemented with 1/10 volume of 1.5M Tris-HCl pH 8.8 (Tris Base Fisher BP152-5, Hydrochloric Acid Fisher A144-212) and 1/10 volume 1 M DTT (Bio Basic DB0058). Samples were boiled for 5 minutes before an additional centrifugation at 4 °C at 16,000 x g for 4 minutes.
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
T. W. Ross, S. L. Poulter, C. Lever, A. Easton,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
All reported experiments took place in an apparatus designed for spontaneous recognition (Model CI.80514R-1, Campden Instruments., U.K.). The specifications of which are previously reported27 ...
-
No products found
because this supplier's products are not listed.
Ori Maller, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-cytokeratin 8+18 antibody (Fitzgerald, Cat# 20R-CP004, dilution 1:400), anti-cytokeratin 5 antibody (Fitzgerald ...
-
No products found
because this supplier's products are not listed.
Yuzuki Shimamori, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were negatively stained with 2% phosphotungstic acid (w/v, pH 7.0) and observed using a JEM-1200EXII electron microscope (JEOL, Japan). Micrographs were taken at an accelerating voltage of 80 kV.
-
No products found
because this supplier's products are not listed.
Rilee Zeinert, et al.,
bioRxiv - Biophysics 2024
Quote:
... and quickly washed with 3 µL of Nano-W Negative Stain (2% methylamine tungstate, Nanoprobes, Yaphank, NY, USA) followed by immediate incubation with 3 µL of Nano-W for 1 additional min ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... COVID-19 convalescent plasma was diluted (1:10) and incubated with recombinant SARS-CoV-2 full-length Spike (BPS Bioscience) for 1 h at 37 °C prior to adding to an hACE2 pre-coated ELISA plates ...
-
No products found
because this supplier's products are not listed.
Miguel Á. Muñoz-Alía, et al.,
bioRxiv - Microbiology 2022
Quote:
Heavy and light chain amino acid sequences were downloaded from the CoV-AbDab database and synthesized as codon-optimized gBlock fragments (GENEWIZ). These antibodies were expressed using the Expi293 expression system kit (Cat# A14635 ...