1 - 50 of 733
suppliers found for
7 AMINO 2 TERT BUTOXYCARBONYL 1 2 3 4 TETRAHYDROISOQUINOLINE 3 CARBOXYLIC ACID
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-W027968-100 mg, 100 mg, USD $50.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cerebral Cortex doi: 10.1093/cercor/bhz081Quote: ... (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a, 200 nM) (Tocris), 7,8-Dihydroxy-2-phenyl-4H-1-benzopyran-4-one (DHF ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay. -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2017Quote: ... Canada) and Methyl 3-[[2-[4-(2-adamantyl) phenoxy] acetyl]amino]-4-hydroxybenzoate (HIF-1α inhibitor) was obtained from Santa Cruz Biotechnology (California ... -
Cayman Chemical
No products found because this supplier's products are not listed.Cited in Influenza A matrix protein M1 induces lipid membrane deformation via protein multimerizationbioRxiv - Biophysics 2019, published in Bioscience Reports doi: 10.1042/BSR20191024Quote: ... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2019, published in Biophysical Journal doi: 10.1016/j.bpj.2019.08.005Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck). -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ... -
Addgene
No products found because this supplier's products are not listed.Cited in USP22 controls type III interferon signaling and SARS-CoV-2 infection through activation of STINGbioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... The 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059, MEK inhibitor) and STAT3 inhibitor VI were from Calbiochem (Darmstadt, Germany). The EGF was from Millipore (Billerica ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017, published in Clinical Epigenetics doi: 10.1186/s13148-017-0391-xQuote: ... SiRNAs against Nipbl (Nipbl-1: 5’-GTGGTCGTTACCGAAACCGAA-3’; Nipbl-2: 5’-AAGGCAGTACTTAGACTTTAA-3’) and Rad21 (5’-CTCGAGAATGGTAATTGTATA-3’) were made by Qiagen. AllStars Negative Control siRNA was obtained from Qiagen. -
VWR
No products found because this supplier's products are not listed.Cited in GUN1-independent retrograde signaling targets the ethylene pathway to repress photomorphogenesisbioRxiv - Plant Biology 2020Quote: 1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Stem Cell Reports doi: 10.1016/j.stemcr.2019.12.007Quote: ... 2 ng ml−1 recombinant human TGFβ1 (112 amino acid, HEK293-derived, Peprotech, 100-21). Cells were routinely maintained in E8 medium on 1:800 diluted growth factor reduced Matrigel (see below) ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in eLife doi: 10.7554/elife.36979Quote: ... Sequences encoding zebrafish Dnah8 (amino acid 895-1402) and Dnah2 (amino acid 802-1378) were subcloned into the pGEX-6P-2 plasmid vector (GE Healthcare). Recombinant polypeptides were purified from transformed E.coli lysate using Ni-NTA Agarose (Qiagen ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ... -
Alfa Aesar
No products found because this supplier's products are not listed.Cited in Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Multiplexed biochemical imaging reveals caspase activation patterns underlying single cell fatebioRxiv - Cancer Biology 2018Quote: ... 7-AAD (7-amino-actinomycin D; Biolegend; 1:200), CaCl2 (2.5 mM ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ... -
IRIS Biotech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ... -
MedChemExpress
Cat# HY-W012974-10 mM * 1 mL, 10 mM * 1 mL, USD $55.0 AskbioRxiv - Cell Biology 2021Quote: ... JQ-1 carboxylic acid (MedChemExpress, cat#202592-23-2); 1,6-hexanediol (Aladdin ... -
Hello Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: All drugs were obtained from Sigma except 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide disodium salt (NBQX) and 2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)pyridazinium bromide (gabazine) which were obtained from Hello Bio (Bristol, UK). -
R&D Systems
No products found because this supplier's products are not listed.Cited in DNAJB1-PRKACA in HEK293T cells induces LINC00473 overexpression that depends on PKA signalingbioRxiv - Cancer Biology 2021Quote: Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018Quote: ... 3-4 million of cells were transfected with 2 μg of plasmid mixed with XtremeGENE HP (Roche) transfection reagent according to manufacturer’s instructions ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA) -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... 2% (w/v) glucose and mixtures of amino acids (MP Biomedicals) depending on the auxotrophies used for selection ... -
Cambridge Isotope Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Egressed parasites were incubated in amino acid-free RPMI supplemented with 2 mg/ml algal [13C]amino acid mix (Cambridge Isotope Laboratories ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
3M
No products found because this supplier's products are not listed.Cited in Expression analysis of Huntington disease mouse models reveals robust striatum disease signaturesbioRxiv - Neuroscience 2022Quote: The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... with patch pipettes (2-3 MΩ) pulled from borosilicate pipettes (TW150-4, WPI, USA) using PC-10 puller (Narishige ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cell Reports doi: 10.1016/j.celrep.2020.107538Quote: ... with medium changes every 2-3 days and passages 1-2 times per week using ReLeSR (Stem Cell Technologies). Heteroplasmy levels were regularly measured to insure they were retained across passage numbers ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 2 (cyanine 3, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Pathology 2021Quote: ... or ethyl-3-4-dihydroxybenzoic acid (DHB, TCI America, Portland) and incubated with collagen (10 µg/ml ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
Worthington Biochemical
Chromatographically purified. A lyophilized powder.Cat# LS006311, Bulk, Inquire AskbioRxiv - Developmental Biology 2019, published in Journal of the American Society of Nephrology doi: 10.1681/ASN.2020010052Quote: ... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ...