-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
All fluorenylmethyloxycarbonyl (Fmoc)-protected amino acids were purchased from Oakwood Chemical or Combi-Blocks ...
-
No products found
because this supplier's products are not listed.
Daniel M. Foulkes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Compounds A (2-[(3-chlorophenyl)amino]-4,6-dimethylnicotinamide) and B 2-[(2,5-dichlorophenyl)amino]-4,6-dimethylnicotinamide were purchased from ChemBridge. Arylsulfonamide 1 was purchased from MolPort ...
-
No products found
because this supplier's products are not listed.
Amy Tarangelo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... or the C’-terminus (amino acids 87-164) were synthesized by IDT DNA (Coralville, IA) and cloned into lentiviral vectors containing a Tet-inducible promoter (pLenti-CMV-TRE3G-Puro ...
-
No products found
because this supplier's products are not listed.
Joshua E. Mayfield, et al.,
bioRxiv - Biochemistry 2021
Quote:
... FAM20C (amino acids 93-584) was subcloned into a modified pI-secSUMOstar vector (LifeSensors, Malvern, PA) in which the original SUMO tag was replaced by a MBP tag and tobacco etch virus (TEV ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Parbir S. Grewal, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Oleate induction media was prepared as 6.7 g/L Difco Yeast Nitrogen Base without amino acids (Spectrum Chemical); 2 g/L Drop-out Mix Synthetic minus appropriate amino acids ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... while injections of CTb 1% (low salt, 1%, List Biological Laboratories, Campbell, CA) in distilled water ...
-
No products found
because this supplier's products are not listed.
Xianyao Zheng, et al.,
bioRxiv - Biochemistry 2023
Quote:
Analysis of Amino acids: A TSKgel Amide-80 HILIC column (250 mm × 2.0 mm, 5 µm, Tosoh Bioscience LLC) was used at column temperature 30°C ...
-
No products found
because this supplier's products are not listed.
Miguel Á. Muñoz-Alía, et al.,
bioRxiv - Microbiology 2022
Quote:
Heavy and light chain amino acid sequences were downloaded from the CoV-AbDab database and synthesized as codon-optimized gBlock fragments (GENEWIZ). These antibodies were expressed using the Expi293 expression system kit (Cat# A14635 ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Hyungsup Kim, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The amino acid substitution methods were used to construct Ano9 mutants using a site-directed mutagenesis kit (Muta-Direct™, Intron Biotechnology). The construction of mutants was verified with DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... on the metabolic activity of primary neurons were evaluated using the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Trevigen, Gaithersburg, MD), a colorimetric test based on the enzymatic activity of NADPH-dependent cytoplasmic oxidoreductase enzymes that catalyze the reduction of the membrane permeable MTT into colorimetric formazan products ...
-
No products found
because this supplier's products are not listed.
Lamiaa El-Shennawy, et al.,
bioRxiv - Immunology 2020
Quote:
RBD of 223 amino acid (Arg319-Phe541) fragment of the SARS-CoV-2 Spike protein that binds to the ACE2 receptor (Raybiotech, 230-30162-100) was biotinylated using NHS-PEG4-Biotin (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Takanari Nakano, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 1-14C-oleic acid was obtained from Moravek Biochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... Imaging strands with a 3’amino group were reacted using succinimidyl ester chemistry with NHS-ATTO 643 (ATTO-TEC, AD 643-31). All reactions were performed at at room temperature in ultrapure water adjusted to pH~8.5 using 1 M sodium bicarbonate (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
Rodrigo S. Maeda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EMG electrodes were made in-house and consisted of Teflon-coated 3 or 7 -strand stainless steel wire with 50 to 100 mm length (A-M Systems, Sequim, WA), threaded into a 30-mm ...
-
No products found
because this supplier's products are not listed.
Lydia M Le Page, et al.,
bioRxiv - Immunology 2019
Quote:
... 24μl [1-13C] pyruvate sample (pyruvic acid, 15mM OX63 trityl radical (Oxford Instruments), and 1.5mM Gad-DOTA ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
No products found
because this supplier's products are not listed.
Connor D. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and QCapture Pro 7 software (Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Gemma Gou, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Brain tissue was homogenized by 30 strokes in 1-mL or 7-mL borosilicate Dounce homogenizers (glass-Teflon tissue grinder; Wheaton, Millville, NJ) depending on the volume of buffer required ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Jessica B. Sarthi, et al.,
bioRxiv - Physiology 2023
Quote:
... Mice were anesthetized with oxygen-delivered isoflurane (1-3%) at 1 L/min via a vaporizer (Braintree Scientific, Inc, Braintree, Mass). Mouse temperature was monitored by rectal probe and maintained at 37°C through automated warming using a controlled warming pad (ATCC 2000 ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Tatiana Lebedeva, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Red Sea Salt) in an optical bottom 35 mm Petri dish (D35-20-1.5-N, Cellvis, US) and imaged with a 20X CFI Plan Apo Lambda Objective (Nikon ...
-
No products found
because this supplier's products are not listed.
Alexander E. Vlahos, et al.,
bioRxiv - Bioengineering 2020
Quote:
... mycophenolic acid (Myfortic, Novartis) and FTY-720 (fingolimod, Biorbyt). ALS was administered as a single i.p ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Myoung Hwan Kim, et al.,
bioRxiv - Bioengineering 2021
Quote:
... osteoclast differentiation marker tartrate-resistant acid phosphatase (TRAP; Kerafast, MA, USA) and Hoechst (Sigma Aldrich Inc) ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Brandon S. Johnson, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and a 3 hr Solusol (National Diagnostics) digestion to dissolve the cell wall fraction ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thibault Rosazza, et al.,
bioRxiv - Immunology 2020
Quote:
All pyroptosis experiments were performed after 3 days of infection using a sequential treatment of 500 ng/ml LPS (Alpha Diagnostic, LPS11-1) for 4 hrs and 5 mM ATP (Sigma ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Wei Ge, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... the slides were then blocked with 3 % BSA and 10 % donkey serum (Boster, Wuhan, China) in 0.5 M Tris-HCI buffer for 30 min ...
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...