-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Oju Jeon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... treated with activated charcoal (5 g/L, 100 mesh, Oakwood Chemical) for 30 min ...
-
Cat# 24188-76-9,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Alexa M. Schmitz, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... was cultured in yeast peptone mannitol (YPM; 5 g L-1 yeast extract (C7341, Hardy Diagnostics, Santa Maria, CA), 3 g L−1 peptone (211677 ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5 mL of Zymolyase 20T (120494-1, AMSBIO) at 5 mg/ml in 10 mM Na2HPO4 ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Fugui Niu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... for 1 hr and laminin (Trevigen, 5 μg/ml) overnight at 37°C ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
because this supplier's products are not listed.
Uxia Gurriaran-Rodriguez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... After 6h of transfection cells were treated overnight with PORCN inhbibitor diluted in DMSO (AdooQ) at two different concentrations 100nM and 500nM in fresh media ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
... BA.5 (ACROBiosystems, SPN-C522e) were used for mouse immunization ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL insulin (CELL technologies), 25 ng/mL hydrocortisone (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Transporter 5 Transfection Reagent (Polyscience, Inc.), or branched 25-kDa polyethyleneimine (PEI ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Filippo Macchi, Eric Edsinger, Kirsten C. Sadler,
bioRxiv - Genomics 2022
Quote:
... or anti-5-methyl-cytosine (5mC – Aviva Biosystem clone 33D3 ...
-
No products found
because this supplier's products are not listed.
Cassandre Bedu-Ferrari, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5% H2 atmosphere (Coy Lab Products, USA) (Text S1) ...
-
No products found
because this supplier's products are not listed.
Pearl V. Ryder, Junnan Fang, Dorothy A. Lerit,
bioRxiv - Developmental Biology 2020
Quote:
... 5-10 mg of frozen embryos were lysed with a 1 mL glass dounce homogenizer (Wheaton) in 100 μL lysis buffer (50 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... KHYG-1 cells was additionally supplemented with 5 ng/mL recombinant human IL-2 (ImmunoTools GmbH, Germany). Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3 ...
-
No products found
because this supplier's products are not listed.
Mengmeng Jin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cells were passaged every 4∼5 days with Accutase (Innovative Cell Technologies) onto Matrigel (BD Biosciences)-coated culture plates at a ratio of 1:4∼1:8 supplemented with ROCK inhibitor Y-27632 (10 mM ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Daniel J. Modulevsky, et al.,
bioRxiv - Bioengineering 2022
Quote:
... a pledgets of surgifoam (5 mm2) were punched out and soaked in 4% FluoroGold (Fluorochrome) in saline ...
-
No products found
because this supplier's products are not listed.
Yining Liu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 8 arm PEG-VS microgels were formulated at a final concentration of 5 wt% (w/v) PEG-VS (JenKem technology) in 0.3 M triethanolamine (Sigma ...
-
No products found
because this supplier's products are not listed.
James W. Smyth, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and twice with PBS (2 x 5 min) before using One-step TUNEL In Situ Apoptosis kit (Green Elab Fluor® 488; Elabscience), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Fernando Salgado-Polo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Cells were trypsinized into single-cell suspensions and then 8×105 cells were incubated with 5 μl of anti-GPC6 antibody LS-C36518 (LifeSpan Bioscience) and in 4 μl of APC anti-HA antibody (Biolegend) ...
-
No products found
because this supplier's products are not listed.
Mark A. Skylar-Scott, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 μM SB431542 (BioGems, #3014193), and 100 nM LDN193189 (BioGems ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Blots were blocked in blocking buffer for 1 hour at room temperature and probed overnight at 4°C for PER2 (1:1000 in 5% BSA and TBST; Alpha Diagnostic Intl., Inc., #PER21-A), BMAL1 (1:1000 in 5% BSA and TBST ...
-
No products found
because this supplier's products are not listed.
Peter Kindgren, Maxim Ivanov, Sebastian Marquardt,
bioRxiv - Genomics 2019
Quote:
... or 5 μM Herboxidiene (Focus Biomolecules) containing plates for 6 or 24 hours ...
-
No products found
because this supplier's products are not listed.
Yi-Cheng Chang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The full coding sequence of Nr6a1 long isoform was synthesised with Notl restriction enzyme site addition at the 5’ and 3’ ends by Biomatik, USA ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
John Grizzanti, et al.,
bioRxiv - Neuroscience 2022
Quote:
... APP/PS1 mice (n=7- 8 mice/group) were anesthetized via isoflurane and tapered catheters (MRE025 tubing, Braintree Scientific) inserted into the jugular vein and the femoral artery ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 µg cholera toxin (List Labs; 100B) in PBS ...
-
No products found
because this supplier's products are not listed.
Katharina MC Klee, et al.,
bioRxiv - Cell Biology 2022
Quote:
Anoctamin 8 (WB 1:500, #HPA049206, Atlas Antibodies), ARHGAP33 (Western-blotting (WB ...
-
No products found
because this supplier's products are not listed.
Chen Sun, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... followed by gentle vortexing for 5 s and centrifugation for 1 min (Benchmark Scientific, MyFuge Mini centrifuge). After droplet breaking ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
S. John Calise, et al.,
bioRxiv - Biochemistry 2023
Quote:
... HeLa cells were seeded at a density of 4 x 104 cells per well in 8-well chambered glass culture slides (Celltreat #229168) and incubated overnight ...
-
No products found
because this supplier's products are not listed.
Thibault Courtellemont, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.5 OD600 units were transferred into 5 mL of SC-arginine/-lysine (Sunrise Science Products) supplemented with 0.43 mM arginine and lysine ...