-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
Cystatin-C ELISA / assay Kit
Cat# K012-H1,
1.0 ea, USD $385.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Francesca Murganti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Cells were fixed with 4% formaldehyde solution in PBS for 10 min and stained overnight at 4 °C with primary antibodies against mVenus (1:800, Biorbyt, orb334993) and mCherry (1:250 ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Jin Nakashima, et al.,
bioRxiv - Plant Biology 2023
Quote:
... E-XEGP (xyloglucan-specific endo-β-(1→4)-glucanase (Megazyme, Wicklow, Ireland) by adding 10 μl endoglucanase solution (0.4U/μl ...
-
No products found
because this supplier's products are not listed.
Matthew S. Penna, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Transfected C2C12 cells were fixed and stained following the same protocol and incubated overnight in 5% FBS and 0.1% triton-X 100 in PBS at 4°C with the following antibodies: anti-mLIMCH1 (1:200, Biomatik), anti-Myc (1:200 ...
-
No products found
because this supplier's products are not listed.
Ciro Maurizio Amato, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Dihydrotestosterone (10-4 M) (Steraloids A2570-011) or Laptinib (1µM ...
-
No products found
because this supplier's products are not listed.
Kimberly E. Stephens, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Cat# 1706404) and incubated overnight at 4°C with primary rabbit polyclonal anti-CEBPG antibody (1:1000; MyBioSource, Cat# MBS8241686) and anti-β-actin antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Hira Khan, Takashi Ochi,
bioRxiv - Plant Biology 2023
Quote:
... 100 mM EDTA and 1 μl of 4 mg/ml Proteinase K (ApexBio Technology) and incubating for 30 min at 50°C ...
-
No products found
because this supplier's products are not listed.
Alexis Vivoli, et al.,
bioRxiv - Cell Biology 2021
Quote:
... islets were washed once with D-PBS + 2 mM EDTA solution (339xg, 3 min, 4°C) and digested by enzymatic disaggregation for 10 min at 37°C using Accutase (Innovative Cell Technologies Inc., San Diego, CA, USA). The reaction was stopped using islet culture medium and the islet cell suspension was washed once with PBS and dead cells labeled using the LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit (405 nm ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 4-1BB (Acrobiosystems) or BSA (Solarbio ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Chi-Chan Lee, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the brain slices were incubated overnight at 4°C with a blocking solution containing Rabbit anti-Per2 (1:1000; Alpha Diagnostic, PER21-A) antibodies ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
10 mM of 10 kDa 4-arm PEG-maleimide (Jenkem Technology, Plano, TX) was reacted with 2mM of the lung integrin-binding peptide cocktail for 10 minutes in 0.5X PBS at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Per Niklas Hedde, et al.,
bioRxiv - Microbiology 2020
Quote:
... The microarray slides used consisted of 2 × 8 pads of 7 mm × 7 mm each (Oncyte Avid, Grace Bio-Labs, Bend, OR). In this configuration ...
-
No products found
because this supplier's products are not listed.
Marissa A. Scavuzzo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... followed by overnight incubation at 4°C with primary antibodies (PDE3A from ProSci 18-159 at 1:500 ...
-
No products found
because this supplier's products are not listed.
Zheng Shi, Sarah Innes-Gold, Adam E. Cohen,
bioRxiv - Neuroscience 2022
Quote:
... Tethers were pulled with a 4 µm diameter polystyrene bead (Spherotech #DIGP-40-2) held at the tip of a micropipette and controlled by micromanipulators ...
-
No products found
because this supplier's products are not listed.
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
No products found
because this supplier's products are not listed.
Annabelle O. Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... CFCS was collected by centrifugation at 4,000 x g for 10 min at 4 °C followed by filtration of the supernatant through a 0.45 μm polyethersulfone (PES) filter (Genesee Scientific, San Diego, CA). To eliminate the effects of differences of pH on yeast inhibition ...
-
No products found
because this supplier's products are not listed.
Anqi Zhang, et al.,
bioRxiv - Bioengineering 2023
Quote:
4-0 silk sutures (Fine Science Tools) were used to ligate the ECA and temporarily stop blood flow in CCA and posterior auricular artery (PAA) ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Hitika Gulabani, et al.,
bioRxiv - Plant Biology 2021
Quote:
... rinsed and incubated overnight at 4°C with indicated primary antibodies [anti-SNC1 (Abiocode; R3588-1), anti-PR1 ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... and incubated overnight at 4°C with the following primary antibodies: STAT-1 (1:600, E-Ab-32977, Elabscience, Houston, Texas, USA); STAT-3 (1:600 ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Bingen G. Monasterio, et al.,
bioRxiv - Biophysics 2020
Quote:
... A mixture of lipid standards (see Table 1) was added and samples were vortexed for 10 min at 4 °C using a Cell Disruptor Genie (Scientific Industries, Inc., Bohemia, NY). MTBE (1.2 mL ...
-
No products found
because this supplier's products are not listed.
Jérémie Prévost, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
No products found
because this supplier's products are not listed.
Shinnosuke Honda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and then incubated overnight at 4°C with a rabbit anti-NANOG antibody (1:100 dilution; RCAB002P-F; ReproCELL, Kanagawa, Japan) and a mouse anti-CDX2 antibody (1:100 dilution ...
-
No products found
because this supplier's products are not listed.
Stephen J. DeCamp, et al.,
bioRxiv - Biophysics 2020
Quote:
Polymerized polyacrylamide gels were first treated with 440 μL of a 1:50 (v/v) mixture of Sulfosuccinimidyl 6-(4'-azido-2'-nitrophenylamino)hexanoate (Sulfo-SANPAH) (ProteoChem) and 50 mM HEPES solution under a UV light for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Flavio R. Palma, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... for 2 h at 4 °C and finally stained with anti-8-oxo-dG (Trevigen, #4354-MC-050), followed by incubation with secondary antibody Alexa647 (Invitrogen #A28181) ...
-
No products found
because this supplier's products are not listed.
Heng Zhou, et al.,
bioRxiv - Biophysics 2019
Quote:
A drop (4 μl) of 10-nm gold colloid (BBI Solutions) was applied to a glow-discharged carbon film (Zhongjingkeyi Technology) ...
-
No products found
because this supplier's products are not listed.
Eros Di Giorgio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 4 µM Random hexamers (Euroclone). qRT-PCRs were performed using SYBR green technology (KAPA Biosystems) ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-4 (786-254B; G-Biosciences), Trypsin-5 (EN-151 ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... were concentrated to 4 mg ml-1 and subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format with 100 nL protein mixed with 100 nL mother liquor in SwissSci 96-well triple drop plates and incubation at 20°C ...
-
No products found
because this supplier's products are not listed.
Stephen K. Dolan, et al.,
bioRxiv - Microbiology 2022
Quote:
... 4°C) and immediately analysed by LC-MS (a QTRAP 6500+ (AB Sciex, Darmstadt, Germany) coupled to an HPLC system (Agilent Infinity 1290)) ...
-
No products found
because this supplier's products are not listed.
Erin A. Akins, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Microglia were polarized to M2 with 50 ng/ml interleukin-4 (IL-4, Bio Basic, RC212-15-5) for 48 hours.
-
No products found
because this supplier's products are not listed.
Benjamin S. O’Brien, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 7% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...