1 - 50 of 735
suppliers found for
7 R AMINO PHENYL ACETAMIDO 3 METHYL 3 CEPHEM 4 CARBOXYLIC ACID DIMETHYLFORMAMIDE 2 1
» view 10000+ matched products-
Alfa Chemistry Sponsored
Cat# ACM39754024, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 6-Formylindolo[3,2-b]carbazole (FICZ) and 2-Methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) from Sigma-Aldrich. 1-HP ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cerebral Cortex doi: 10.1093/cercor/bhz081Quote: ... (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a, 200 nM) (Tocris), 7,8-Dihydroxy-2-phenyl-4H-1-benzopyran-4-one (DHF ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in Host metabolic reprogramming of Pseudomonas aeruginosa by phage-based quorum sensing modulationbioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in DNAJB1-PRKACA in HEK293T cells induces LINC00473 overexpression that depends on PKA signalingbioRxiv - Cancer Biology 2021Quote: Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2017Quote: ... Canada) and Methyl 3-[[2-[4-(2-adamantyl) phenoxy] acetyl]amino]-4-hydroxybenzoate (HIF-1α inhibitor) was obtained from Santa Cruz Biotechnology (California ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Er-tiprotafib from MedKoo Biosciences ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Corning) and 1% penicillin-streptomycin (Gibco) ... -
VWR
No products found because this supplier's products are not listed.Cited in GUN1-independent retrograde signaling targets the ethylene pathway to repress photomorphogenesisbioRxiv - Plant Biology 2020Quote: 1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2019, published in Biophysical Journal doi: 10.1016/j.bpj.2019.08.005Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck). -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... R-anti-14-3-3ε (Cell Signaling Technology, 1:1000), M-anti-Flag M2 (Sigma ... -
Hello Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... (Cat. N° 487910) and 3-amino,4-aminomethyl-2’,7’-difluorofluorescein (DAF-FM) (Cat. N° 251515) were obtained from Calbiochem (San Diego, CA, USA). EZ-link HPDP-Biotin (Cat ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Frontiers in Microbiology doi: 10.3389/fmicb.2018.00193Quote: To test whether the NO-scavenger 2-phenyl-4,4,5,5,-tetramethylimidazoline-3-oxide-1-oxyl (PTIO; TCI, Germany) inhibits ammonia oxidation by Ca ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific). -
Toronto Research Chemical
No products found because this supplier's products are not listed.Cited in Mapping protein interactions of sodium channel NaV1.7 using epitope-tagged gene targeted micebioRxiv - Neuroscience 2017, published in The EMBO Journal doi: 10.15252/embj.201796692Quote: ... The following compounds were used in electrophysiology experiments: Lacosamide ((R)-2-acetamido-N-benzyl-3- methoxypropionamide) was obtained from Toronto Research Chemicals Inc (L098500 ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Structures of PKA-phospholamban complexes reveal a mechanism of familial dilated cardiomyopathybioRxiv - Biochemistry 2021Quote: ... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ). -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Multiplexed biochemical imaging reveals caspase activation patterns underlying single cell fatebioRxiv - Cancer Biology 2018Quote: ... 7-AAD (7-amino-actinomycin D; Biolegend; 1:200), CaCl2 (2.5 mM ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: Plasmids encompassing the non-canonical amino acid residue p-benzoyl-L-phenyl alanine (Bpa, Alfa Aesar #52083) were generated by inserting a TAG stop codon at the desired crosslinking position in the appropriate plasmid (construction detailed above) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ... -
IRIS Biotech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 6 mM amino acid mixture (average concentration of each amino acid 0.3 mM) and 0.1% (w/v) MNG-3 (Maltose Neopentyl Glycol-3, Anatrace). The feeding buffer contained 1x SUB-AMIX buffer (CellFree Sciences Japan) ... -
Cambridge Isotope Labs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: 3 μL of human plasma were spiked with 3 μL amino acid isotope labelled internal standards (Cambridge Isotope Laboratories, #MSK-A2-1.2) and extracted with 250 μL –20 °C methanol for 10 min and centrifuged at 4°C for 10 min at 15 000 g ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: Polybead Amino Microsphere 3 μm latex beads (Polysciences INC) were labeled with the fluorescent dye DyLight680 mono-N-hydroxysuccinimide (NHS ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
Peprotech
No products found because this supplier's products are not listed.Cited in Spatially-Resolved Live Cell Tagging and Isolation Using Protected Photoactivatable Cell DyesbioRxiv - Systems Biology 2020Quote: ... and R-spondin 3 (500 ng/ml, PeproTech) and conditioned media supplement Afamin-Wnt3a (10X ... -
Bachem
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: Z-RLRGG-7-amino-4-methyl-courmarin (peptide-AMC) was purchased from Bachem. Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Angewandte Chemie doi: 10.1002/ange.201914449Quote: ... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... AEC (3-Amino-9-EthylCarbazole; Vector Laboratories, Burlingame, CA) was used as chromogen ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: Gly-Phe-7-Amino-4-Trifluoromethylcoumarin (GF-AFC, MP biomedicals, SKU 03AFC03325) substrate was diluted in PBS and 1.0 μL/well was added with a Multidrop Combi Reagent Dispenser (Thermo Fisher ... -
Jena Bioscience
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2017Quote: 7-methyl GTP (m7GTP) sepharose (Jena Bioscience) and sepharose (Sigma ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ... -
MedChemExpress
Cat# HY-W016798-10 mM * 1 mL, 10 mM * 1 mL, USD $231.0 AskbioRxiv - Cell Biology 2021Quote: ... JQ-1 carboxylic acid (MedChemExpress, cat#202592-23-2); 1,6-hexanediol (Aladdin ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA) -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020, published in The EMBO Journal doi: 10.15252/embj.2020106267Quote: ... IFITM2/3 (#66081-1-Ig, Proteintech) 1:250 for FACS ...