-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... Endothelium-intact or -denuded rings were mounted on tungsten wires and immersed in PSS at 37°C with constant gassing (21% O2 and 5% CO2) in a wire myography chamber (DMT 610) and incubated ex vivo with oxLDL (50μg/dL; 2h; Kalen Biomedical, cat. no. 770202-7), followed by normalization and KCL (100mM ...
-
WB, ChIP, DB, ICC/IF
Cat# CDC-98,
0.025 mg;0.05 mg, Inquire
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Darryl A. Wesener, et al.,
bioRxiv - Microbiology 2020
Quote:
... [1,2,3,4,5,6- 2H]-Myo-inositol (CDN Isotopes) was used as an internal standard ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Gokhan Unlu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 x105 cells were placed in a microfuge tube and incubated with 2 μM ZnMP (Frontier Scientific) in 1x HBSS for 15 min at room temperature ...
-
PAR-2(1-6) is a peptide.
Cat# abx265052-5MG,
5 mg USD $246.5
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
Cat# G209,
USD $10.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Daniel Lustberg, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and NET (mouse anti-NET; MAb Technologies, Neenah, WI, NET05-2; 1:1000). After washing in 0.01 M PBS ...
-
No products found
because this supplier's products are not listed.
Sanghwa Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and then immunoblotted using anti-HY5 (Abiocode, Cat. R1245-2, dilution 1:3000), anti-NRT1.1 (Agrisera ...
-
No products found
because this supplier's products are not listed.
Brittany G. Seman, et al.,
bioRxiv - Immunology 2019
Quote:
... the culture was supplemented with 100 units of interleukin-2 (IL-2; Shenandoah Biotech, Warwick, PA) or 3×105 CD3/CD28 Dynabeads/well (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 mg/mL fibrinogen (Enzyme Research Laboratories), 0.1 mg/mL Alexa-Fluor 488 labeled fibrinogen for visualization (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Emilie Boucher, et al.,
bioRxiv - Immunology 2022
Quote:
... and OVA-dextramer (H-2 Kb) (Immudex) (Table S2).
-
No products found
because this supplier's products are not listed.
Yulong Wei, et al.,
bioRxiv - Bioengineering 2021
Quote:
Young (1-2 weeks old) bovine knee joints were obtained from Vendors (Lampire biological laboratories), and cartilage explants were harvested from the trochlear groove using biopsy punch and cultured with chemically defined medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Prakash Thapa, et al.,
bioRxiv - Immunology 2019
Quote:
... with 2% human serum (Valley Biomedical Products & Services) with 800 U/mL granulocytemacrophage colony-stimulating factor (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silicon cuff was placed around the nerve and closed with one stitch of 6-O nylon suture (McKesson, REF S1698GX), and the receiver was placed subcutaneously proximal to the cuff ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Vytaute Boreikaite, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... coli codon-optimised genes encoding each full-length protein and isoform 2 of CPSF30 (Uniprot O95639-2) in pACEBac vectors were synthesized by Epoch Life Science. All cloning was validated by sequencing (Source Bioscience).
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... SARS-CoV-2 pseudovirus productions were quantified by RETRO-TEK HIV-1 p24 ELISA according to manufacturer instructions (ZeptoMetrix Corporation).
-
No products found
because this supplier's products are not listed.
Luis E. Villegas-Hernández, et al.,
bioRxiv - Pathology 2021
Quote:
... using a cryo-immuno diamond knife (35° - size 2 mm, Diatome). The cryosections were transferred to photonic chips fitted with a PDMS frame and stored at 4 °C before staining ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
CIC were determined by 2 different ELISA’s from Quidel (San Diego, CA): the CIC-C1q enzyme immunoassay is based on the principle that complement fixing IC will bind to immobilized human C1q purified protein ...
-
No products found
because this supplier's products are not listed.
Jesse R. Holt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Keratinocytes were imaged following at least 2 days in Cnt-Pr-D (CellnTec) differentiation media.
-
No products found
because this supplier's products are not listed.
Shota Yoshida, et al.,
bioRxiv - Immunology 2020
Quote:
... Synthetic SARS-CoV-2 peptides (Appendix Table S2; Peptide Institute Inc., Osaka, Japan) were diluted to a concentration of 10 μg/ml and coated at 500 ng/well ...
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 2×104 Target cells were seeded into 96 well E-Plate (ACEA Biosciences Inc.) and rested overnight ...
-
No products found
because this supplier's products are not listed.
Bruno Rafael Barboza, et al.,
bioRxiv - Microbiology 2023
Quote:
... and incubated with primary antibodies: mouse anti-cardiac troponin T (HyTest clone 4T19/2) and rabbit anti-α-actinin (Millipore ...
-
No products found
because this supplier's products are not listed.
Pavlo Gilchuk, et al.,
bioRxiv - Immunology 2020
Quote:
... mice were treated with 2 mg of an Ifnar1-blocking antibody (MAR1-5A3, Leinco Technologies) by i.p ...
-
No products found
because this supplier's products are not listed.
Quentin Defenouillere, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The 2-NBDG signal was visualized using a GFP filter set (41020 from Chroma Technology, Bellows Falls ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Hélène Duplus-Bottin, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... we added 20 µl of a 2 mg/ml Zymolyase stock solution (SEIKAGAKU, 20 U/mg) to the cell suspension and incubated it for 1h at 37°C for cell wall digestion ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Brandon C. Farmer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... aged 2-4 months (young) and group housed in sterile micro-isolator cages (Lab Products, Maywood, NJ), and fed autoclaved food and acidified water ad libitum ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Niklas Schandry, et al.,
bioRxiv - Plant Biology 2021
Quote:
Individual isolates were pre-cultured in ½ strength TSB medium in 96-Well 2 ml deep-well plates (Semadeni) covered with a Breathe-Easy (Diversified Biotech) membrane until stationary phase for 6 d at 28°C and 180 rpm ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...