-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Simon Amiard, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and chromatin sonicated using the Diagenode Bioruptor (set to high intensity, 3 times 7 cyles (30sec ON / 30 sec OFF) or the S220 Focused-ultrasonicator (Covaris) for 20 min at peak power 110 W ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Claire V. Mulholland, et al.,
bioRxiv - Microbiology 2023
Quote:
Mtb cultures were grown to early log phase and then diluted to OD600 0.3 in 10 ml 7H9/OADC/glycerol/tyloxapol and labelled with propionic acid [1-14C] sodium salt (7 μCi) (American Radiolabeled Chemicals, Inc.). Cultures were incubated with shaking at 37 °C for two days and then spun down ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Rodrigo S. Maeda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EMG electrodes were made in-house and consisted of Teflon-coated 3 or 7 -strand stainless steel wire with 50 to 100 mm length (A-M Systems, Sequim, WA), threaded into a 30-mm ...
-
No products found
because this supplier's products are not listed.
Ou Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 70 µL serum was applied to the human obesity array (RayBiotech, #QAH-ADI-3-2) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Cori K. Cahoon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
The quantification of GFP::SYP-2 and mCherry::SYP-3 was performed using Imaris (Oxford Instruments) in combination with our whole gonad analysis ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
Natalya Leneva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with 3 mol% of dipalmitoyl-phosphatidylinositol-3-phosphate (PI(3)P) (Echelon Biosciences) were prepared at a lipid concentration of 0.5 mg/ml in Buffer A by extrusion through a 0.4 μm polycarbonate filter (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Samuel G. Nonis, et al.,
bioRxiv - Biochemistry 2020
Quote:
... pH 7 from the ProPlex crystallisation screen (Molecular Dimensions). An additive screen was then performed using the sitting-drop vapour diffusion method with 30 μL of reservoir solution (125 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Shahzad S. Khan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the other group (7 mice) received untreated diet (Research Diets D01060501) for 14 days and served as the control group ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Mason A. McCool, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Swollen cells were dounced using a 7 mL dounce (Wheaton, 3575420) for 20 strokes ...
-
No products found
because this supplier's products are not listed.
Amalia Sintou, et al.,
bioRxiv - Immunology 2019
Quote:
... Apoptosis assays were performed using Nucleocounter NC-3000 and a Flexicyte apoptosis/necrosis detection kit based on staining with caspase 3 substrate NucView 488 and RedDot 2 (all Biotium, Cambridge Bioscience, UK). Apoptotic cells are defined as NucView488 positive and RedDot2 negative ...
-
No products found
because this supplier's products are not listed.
Paige D. Diamond, et al.,
bioRxiv - Genomics 2023
Quote:
... Cells were washed with PBS with 2mM EDTA and permeabilized at 45°C with 2% w/v sodium lauroyl sarcosine (Bioworld #41930024-3) in PBS for 15 minutes (Abraham and Bhat ...
-
No products found
because this supplier's products are not listed.
Ben Jin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... supplied with 7 ml of Dulbecco’s Modified Eagle’s Medium (Genesee, #25-500) containing 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The cleared lysate was incubated with an equivalent of 7 μl GFP-trap slurry (Chromotek) for 6 h at 4°C on a rotor ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Samuel Vega Estevez, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were grown overnight and spheroplast were prepared in an agarose plug by treating cells (~ OD600=7) with 0.6 mg/ml Zymolyase 100T (Amsbio #120493-1) in 1% Low Melt agarose (Biorad® # 1613112) ...
-
No products found
because this supplier's products are not listed.
Kritika Khanna, et al.,
bioRxiv - Microbiology 2021
Quote:
... or BHK-21/WI-2 (Kerafast) cells were transfected with SARS-CoV-2 Spike expression plasmid (pTT5 SARS-CoV-2 SΔ21) ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Jacob J. Kennedy, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 μm and a trap (IntegraFrit™ Capillary, 100 μm ID × 2 cm, New Objective) packed with Magic C18 AQ ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Zezhong Zheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
Gene editing of COS-7 cells were performed by electroporation of COS-7 cells with Super PiggyBac plasmid (PB210PA-1, System Biosciences) and one of the 5 plasmids of pBv1-EF-6X ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... on a heated stir plate (IKA C-MAG HS 7) set to 30°C and ~250 rpm ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... on the metabolic activity of primary neurons were evaluated using the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Trevigen, Gaithersburg, MD), a colorimetric test based on the enzymatic activity of NADPH-dependent cytoplasmic oxidoreductase enzymes that catalyze the reduction of the membrane permeable MTT into colorimetric formazan products ...
-
No products found
because this supplier's products are not listed.
Daisy Precilla S, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Caspase-3 (Cat. No: E-EL-R0160) and BCL-2 (Cat. No: E-EL-H0114) ELISA kits were purchased from Elabscience Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Kyung Ku Jang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Elia Obis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-ketoacyl-CoA thiolase (MyBioSource MBS1492126) used at a dilution of 1/100 ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...