-
No products found
because this supplier's products are not listed.
Lars Kaiser, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Caspase 3/7 activation was measured using the Apo-ONE Homogenous Caspase-3/7 Assay (Promega), following the manufacturers protocol ...
-
No products found
because this supplier's products are not listed.
Joseph O. Magliozzi, James B. Moseley,
bioRxiv - Cell Biology 2021
Quote:
... all strains were grown in YE4S at 32°C and treated with 30 μM 3-Brb-PP1 (3-[(3-Bromophenyl)methyl]-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (Abcam) for 1 h and fixed in ice-cold 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Yan Li, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... or 1000 nM of 2-(4-amino-1-isopropyl-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol (PP242; Sigma, P0037), (2 ...
-
No products found
because this supplier's products are not listed.
Alanna V. Van Huizen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Alison Dumont, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3/7 dye (4440, Sartorius, 1/1000) and/or propidium Iodide (PI ...
-
No products found
because this supplier's products are not listed.
Alan Hicks, et al.,
bioRxiv - Biophysics 2020
Quote:
... or (iv) POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) at 7:3 ratio (all lipids from Avanti Polar Lipids). The protein-liposome mixtures ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Mukaddes Izci, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
No products found
because this supplier's products are not listed.
Kazuki Yoshizumi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Jose A. Valverde-Lopez, et al.,
bioRxiv - Developmental Biology 2023
Quote:
FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
No products found
because this supplier's products are not listed.
José A. Noriega-Prieto, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the IGF-1R antagonist 7-[cis-3-(1-azetidinylmethyl)cyclobutyl]-5-[3-(phenylmethoxy)phenyl]-7H-pyrrolo[2,3-]pyrimidin-4-amine (NVP-AEW 541, 40 μM; Cayman Chemicals) plus IGF-1 were infused into the IL ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Josephine G. M. Strijker, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... at 3:1 bead: T-cell ratio together with human recombinant IL-15 and IL-7 (PeproTech; 5 ng/mL) in AIM-V medium supplemented with 5% FBS ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Constanza Salinas-Rebolledo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Laura Micheli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... PlGF-2 (3 – 30 ng; 5 µl; cat.465-PL/CF, R&D System, USA), VEGF-E (3 – 30 ng ...
-
Glucocorticoid modulator
Sold for research purposes only.
Cat# 1176.0, SKU# 1176-10 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Charley Mackenzie-Kludas, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 1 μg/ml L-1-tosylamido-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemicals). Plaque forming units (PFU ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Matthew T. Blahna, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Supernatant medium from treated PASM cells was mixed 1:1 with 25 µL Caspase-Glo 3/7 substrate in a solid white polystyrene 96-well Assay Plate (Corning) and set at room temperature for 30 min prior to reading with a GloMax luminometer (Promega) ...
-
Cat# HY-W013014-500 mg,
500 mg, USD $50.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Alissandra L. Hillis, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and 1:1000 NucView 488 Caspase-3/7 substrate (Biotium, 30029). Cells were treated with 10 µL of drug-containing media ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Thi Tuyet Trinh Phan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... MTT (3-(4,5-dimethylthiazol-2-yl-2, 5-diphenyl tetrazolium bromide)) was purchased from Alfa Aesar (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Neil Fleck, Christoph Grundner,
bioRxiv - Genetics 2021
Quote:
... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
No products found
because this supplier's products are not listed.
Adeline M. Fanni, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the grid was stained one time for 3 minutes and three times for 1-minute each using 2% uranyl acetate (Electron Microscopy Sciences, Hatfield, PA). Excess stain was wicked away in between the steps ...
-
No products found
because this supplier's products are not listed.
Adam B. Yasunaga, Isaac T.S. Li,
bioRxiv - Biophysics 2021
Quote:
... the coverslips/slides were placed in a 1% aminosilane solution (94 mL methanol, 1 mL 3-(2-aminoethylamino)propyltrimethoxysilane (VWR, CAS# 1760-24-3), 5 mL glacial acetic acid ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Muriel Sébastien, et al.,
bioRxiv - Cell Biology 2024
Quote:
... They were grown for 3-7 days in BrainPhys basal media (#05790, Stemcell Technologies), supplemented with SM1 (#05711 ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...