-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F1,
1.0 ea, USD $390.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Christopher J. DiRusso, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 0.4 M solution of 2-(7-aza-1Hbenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (Chem-Impex International) was prepared in DMF and 2.5 ml was used to dissolve 1 mmol of each Nα Fmoc-protected aa (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Lucia Gonzalo, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and serine 2 (Chromotek, diluted 1:200). After washing with PBS ...
-
No products found
because this supplier's products are not listed.
Megan Clapperton, et al.,
bioRxiv - Biophysics 2023
Quote:
... and fluorescence (PMT 2).
-
No products found
because this supplier's products are not listed.
Biswarathan Ramani, et al.,
bioRxiv - Genomics 2023
Quote:
... 2: rabbit anti-tRFP (1:1,000 dilution, polyclonal, Evrogen, AB233). The following secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
J. Z. Alex Cheong, et al.,
bioRxiv - Microbiology 2021
Quote:
... with 0.2 g of 1 mm sterile glass beads for 10 min at full-speed on a Vortex-Genie 2 (Scientific Industries, Bohemia, NY) before serial dilution and spot plating 20 μL on TSA plates with no antibiotic supplementation.
-
No products found
because this supplier's products are not listed.
Sarah V. Paramore, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The probes were for Mus musculus Fgf10 (channel 2, 446371) and Wnt5a (channel 2, 316791) and the fluorophores were Opal Polaris 520 and Opal 620 (Akoya Biosciences FP1487001KT and FP1495001KT) ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Sumeda Nandadasa, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Each sample was labeled with 2 units of each channel by adding 1 sample volume of dimethyl sulfoxide (DMSO) to each iTRAQ label (Sciex, catalog no.4390812) before adding the total solution volume to each sample ...
-
No products found
because this supplier's products are not listed.
Kjetil Hodne, et al.,
bioRxiv - Physiology 2019
Quote:
... In each culture 2-7 primary target cells were stimulated by 1 μM Gnrh1 (Bachem Americas, Inc. CA, USA).
-
No products found
because this supplier's products are not listed.
Jiaxi Wang, et al.,
bioRxiv - Immunology 2021
Quote:
... 2 mM EDTA (TekNova), in PBS (MACS buffer) ...
-
No products found
because this supplier's products are not listed.
Chao Hu, et al.,
bioRxiv - Immunology 2020
Quote:
... type 2 (Trevigen, USA). Drops of 40 μl BME-cell suspension were added into 24-well plates and solidified at 37°C for 10-20 min ...
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Peak 2 (RCP-60-50-2) and Polystyrene DVB-COOH microspheres from Bangs Laboratories, Inc (PC07001 ...
-
No products found
because this supplier's products are not listed.
Preeti Sareen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... An image splitter (Photometrics DV-2) was used to split red and green channels and acquire simultaneous images for tdTomato and GCaMP6 using a Hamamatsu ORCA-R2 C10600 camera ...
-
No products found
because this supplier's products are not listed.
Yusuke Nasu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... by a Nanoject 2 (Drummond Scientific). Five ...
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 M (MyBioSource, MBS8574735) and SARS-CoV-2 E (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Connor R. Quinn, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2% cholesterol (Research Diets # D09100310i). Control animals received a CHOW diet ...
-
No products found
because this supplier's products are not listed.
Nicholas O. Burton, et al.,
bioRxiv - Genetics 2021
Quote:
... mek-2 and gpdh-2 was synthesized and cloned into the L4440 vector by GENEWIZ (Takeley, UK). Vectors were transformed in E ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...
-
No products found
because this supplier's products are not listed.
Zhikun Wu, et al.,
bioRxiv - Genetics 2021
Quote:
... and 2 μg DNA was Fragmented by g-TUBE (Covaris). DNA repair was performed using NEBNext FFPE DNA Repair Mix (M6630L ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2% peptone (20-260, Genesee Scientific), and 4% dextrose ...
-
No products found
because this supplier's products are not listed.
Mansi Prakash, et al.,
bioRxiv - Neuroscience 2021
Quote:
... containing 2 mg/ml papain (BrainBits). Papain solution was removed ...
-
No products found
because this supplier's products are not listed.
Yicheng Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... [2-3H] Mannose (American Radiolabeled Chemicals) was added to 25 Ci/ml ...
-
No products found
because this supplier's products are not listed.
Luyao Ao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... IL-2 (E-EL-H0099, Elabscience), and GZMB (E-EL-H1617c ...
-
No products found
because this supplier's products are not listed.
Pinelopi Pliota, et al.,
bioRxiv - Genetics 2022
Quote:
... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Hillary A. Wadsworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 5-(3-Bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) (cat. no. T22518, TargetMol, Wellesley Hills, Massachusetts, USA) were dissolved in stock solutions and then diluted into ACSF at specified concentrations (50 µM IVM ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
2 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C2-1.5H-N,
48/case, $219.00
Ask
Laura R Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 5 mL of 1/2 MS with 2% low melt agarose was cast into imaging cuvettes (CellVis product number #C1-1.5H-N) after being filtered through a 0.45 micron nylon filter to remove any particulates that might disturb the path of the light sheet to prepare media “blankets” ...
-
No products found
because this supplier's products are not listed.
Daniel Wrapp, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 μL of protein was deposited on an UltrAuFoil 1.2/1.3 grid that was plasma cleaned at 25 mA for 2 minutes using a Solarus plasma cleaner (Gatan). Excess liquid was blotted away for 3 seconds in a Vitrobot Mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Renee L. Hajnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-2-APC (Tonbo bioscience, 20-7021) on ice for 30 min ...
-
No products found
because this supplier's products are not listed.
Ana L. Pereira, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2’,7’-dichlorodihydrofluorescein diacetate (DCFDA, Cell Biolabs) were used for mitochondrial and intracellular ROS staining ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Shirin Fatma, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 2’,2’-cGAMP were purchased from Axxora. All synthetic cyclic dinucleotides were further HPLC purified ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Laura E. Burnett, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PAG tissue was dissected using a 2 mm diameter biopsy punch (ID: 2 mm, OD: 3 mm, Fine Science Tools, 18035-02). Each purification was performed independently three times and samples were stored at -80 °C until further processing ...
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Lindsey N. Block, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 2% FBS (Peak Serum, Wellington ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were washed 3 times in PBS and incubated for 2 h with adequate secondary antibody (Dianova, Hamburg, Germany; Table 1) solution without Triton™-X-100 ...
-
No products found
because this supplier's products are not listed.
Kerri L. Miazgowicz, et al.,
bioRxiv - Microbiology 2022
Quote:
... Transfected cells were rapidly cooled and stained in blocking solution (dPBS with 2% (v/v) bovine serum albumin (BSA)) containing anti-MXRA8 (1:100, W040-3, MBL International), anti-hTIM1(1:100 ...
-
No products found
because this supplier's products are not listed.
Farhan Ali, et al.,
bioRxiv - Neuroscience 2019
Quote:
We fabricated bundles of stainless steel wire electrodes (2-3 wires per bundle) (790500, A-M Systems). The diameter of an electrode was 114.3 µm and 50.8 µm with and without coating respectively ...
-
LC Laboratories' Product Number T-8040 - Temsirolimus (CCI-779, Torisel, CAS 162635-04-3), 99% -...
Cat# T-8040, SKU# T-8040-200mg,
200 mg, $535.00
Ask
Jing Fan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 2 µM Olaparib (LC laboratories, O-9201) and 20 nM BMN673 (Selleckchem ...
-
No products found
because this supplier's products are not listed.
Rilee Zeinert, et al.,
bioRxiv - Biophysics 2024
Quote:
... and quickly washed with 3 µL of Nano-W Negative Stain (2% methylamine tungstate, Nanoprobes, Yaphank, NY, USA) followed by immediate incubation with 3 µL of Nano-W for 1 additional min ...
-
No products found
because this supplier's products are not listed.
Leah M. Williams, et al.,
bioRxiv - Cell Biology 2019
Quote:
... a piece of tissue approximately 2 cm by 2 cm was placed into a glass dounce tissue grinder (Wheaton USA) with 1 ml of AT Lysis Buffer and protease inhibitors (described above) ...
-
No products found
because this supplier's products are not listed.
Bhagyashree Deshmukh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 2 mM PMSF) at parameters of 3 sec ON/ 5 sec OFF/ 60% amplitude (Probe sonicator Thomas Scientific). The supernatant was separated by spinning at 12,000 RPM ...
-
No products found
because this supplier's products are not listed.
Phoebe Ohene-Marfo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... and 2% Cholesterol (D09100310, Research Diets Inc, New Brunswick, NJ) or a matched control diet (D09100304,Research Diets Inc ...