-
No products found
because this supplier's products are not listed.
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1 mM 2’F-Py (2’F-2’-dCTP and 2’F-2’-dUTP, TriLink Biotechnologies), 1 mM ATP ...
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Sebastian N.W. Hoernstein, et al.,
bioRxiv - Plant Biology 2022
Quote:
... diluted 1:10,000 in 2% TBST with 2% Blocking (GE Healthcare), was applied for 1 h.
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 × 105 Huh-7 cells were grown in a 35 mm dish (ibidi) with growth medium ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Synergy 2 (BioTek).
-
No products found
because this supplier's products are not listed.
Yang Wang, et al.,
bioRxiv - Microbiology 2024
Quote:
... IL-2 (Mabtech, 3441-4HPW-2), IL-4 (Dakewe Biotech ...
-
No products found
because this supplier's products are not listed.
Theresa K Leslie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then were incubated for 10 minutes at 21 °C in 1 μM 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM, Biotium) in PSS ...
-
No products found
because this supplier's products are not listed.
Patrícia D. Correia, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats were anesthetized with Isoflurane (Forene, Abbott; 2–3% in O2 and N2O at a ratio of 1:2). Following laminectomy at T8/9 and opening of the dura mater via a longitudinal cut ...
-
No products found
because this supplier's products are not listed.
Jari Jukkola, et al.,
bioRxiv - Neuroscience 2023
Quote:
2- to 3-month-old C57/Bl6N (Charles River) female mice were used in all experiments ...
-
No products found
because this supplier's products are not listed.
Osvaldo Artimagnella, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2% FBS (Euroclone), 1X Pen/Strept (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Kousuke Mouri, et al.,
bioRxiv - Genetics 2021
Quote:
... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Sara C.M. Leijon, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 2 software (Olympus) and digitized/stabilized using FIJI (ImageJ) ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Andrea Salm, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 2-hydroxy-3-methylanthraquinone (13) and 2-hydroxy-1-methylanthraquinone (14) were obtained from Toronto Research Chemical, ON ...
-
No products found
because this supplier's products are not listed.
Luiza Filipis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4-(2,1,3-Benzoxadiazol-4-yl)-1,4-dihydro-2,6-dimethyl-3,5-pyridinecarboxylic acid methyl 1-methylethyl ester (isradipine or isr) (HelloBio) was initially dissolved at 20 mM in DMSO and then diluted in external solution 20 μM just before use ...
-
No products found
because this supplier's products are not listed.
Reena P. Murmu, et al.,
bioRxiv - Neuroscience 2019
Quote:
A glass micropipette (1–3 MΩ impedance; 2-μm tip; World Precision Instruments) was connected to a pneumatic injector (3–20 PSI ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... while Lab 2 used Antibody 2 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Charlotte H. Hurst, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Calnexin 1/2 (Agrisera AS12 2365) and UDP-glucose pyrophosphorylase (Agrisera AS05 086 ...
-
2,3-Benzofuran is a mutagenic and carcinogenic compound.
Cat# S5587, SKU# S5587-25mg,
25mg, $97.00
Ask
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 nM GSK2110183 (AKT1/2/3 inhibitor; Selleck Chemicals #S7521), 1 μM AG-490 (JAK2 inhibitor with effects on EGFR kinase ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Sayantan Roy, Bing Wang, Yuan Tian, Qian Yin,
bioRxiv - Biochemistry 2023
Quote:
... 5 mM MgCl2 and 2 mM Tris (2-carboxyethyl) phosphine (TCEP, GoldBio).
-
No products found
because this supplier's products are not listed.
Xiaocui Luo, et al.,
bioRxiv - Immunology 2023
Quote:
... or 2 μg/ml anti-mouse IgM F(ab’)2 (Jackson ImmunoResearch), or 5 μg/ml anti-mouse CD40 (clone FGK4.5/ FGK45 ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Marta Varela-Eirín, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1 ng/ml recombinant human fibroblast growth factor-2 (rhFGF-2; Immunotools) or in MesenPRO RS™ Medium supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin.
-
No products found
because this supplier's products are not listed.
Victoria L. Bolton, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and Z)-1-[2-(2-Aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA/NONOate) (ALX-430-014-M005, Enzo Life sciences) involved plating cells in 96-well plates at a final density of 1x106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Sahil Nagpal, et al.,
bioRxiv - Biophysics 2023
Quote:
U-2 OS and COS-7 cells were obtained from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Shuting Cao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the dried pellet was dissolved in 550 µl D2O containing 0.01 mg/ml Sodium 2,2-Dimethyl-2-Silapentane-5-Sulfonate (DSS; Cambridge Isotope). The samples were then vortexed and centrifuged at 16000 rpm for 12 min ...
-
No products found
because this supplier's products are not listed.
Logan R. Hurst, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2% dextrose (RPI)] ...
-
No products found
because this supplier's products are not listed.
Ryo Fujita, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2% UltroserG (Pall Life Sciences). When indicated ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Heta P. Patel, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and bead beating 7×2 min in a Mini-Beadbeater-96 (Biospec #1001). The lysate was recovered and centrifuged to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Tingting Lan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2%DMSO (Amresco), 200μM Butylated hydroxyanisole (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Claudio Asencio, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and MagBead DNA/RNA Wash 2 buffer (#R2130-2, Zymo Research). After magnetically pelleted ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners ...
-
No products found
because this supplier's products are not listed.
Julien Scaviner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Cells were labelled with 2⍰μM Fura-2 QBT (Molecular Devices, UK) for 60⍰min at 37⍰°C in buffer containing (in mM ...
-
No products found
because this supplier's products are not listed.
Vladimir Ugorets, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 2% HS (PAN Biotech), 2 mM L-glutamine and penicillin (100 units/mL ...
-
No products found
because this supplier's products are not listed.
Jeremy A. Spool, et al.,
bioRxiv - Neuroscience 2020
Quote:
... brains were placed in 2 x 2 x 2 inch plastic blocks filled with cryo-embedding compound (Ted Pella Inc., Redding, CA). Brains were sectioned coronally at 40 microns and sections were stored in cryoprotectant solution (30 % sucrose ...
-
No products found
because this supplier's products are not listed.
Guang Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or a Ti-2 microscope (Nikon) equipped with ×60 1.4 NA Apochromatic ...
-
No products found
because this supplier's products are not listed.
Amelia Trimarco, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 20.000 rpm for 2 hours (Beckman). Collected viral particles were then suspended in DMEM and stored to –80°C ...