-
No products found
because this supplier's products are not listed.
Greg. A. Timblin, et al.,
bioRxiv - Immunology 2022
Quote:
... 4-phosphopantetheine (CX11340) was from Chiralix. MPLA (tlrl-mpls) ...
-
No products found
because this supplier's products are not listed.
Candice B. Herber, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 4’-trihydroxychalcone were obtained from INDOFINE Chemical Company (Hillsborough ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Franziska Herster, et al.,
bioRxiv - Immunology 2019
Quote:
... 4 μg/g of anti-CD42b (clone R300, Emfret Analytics) or rat IgG isotype control (clone R301 ...
-
Robert H. Utama, et al.,
bioRxiv - Bioengineering 2021
Quote:
4-arm PEG-maleimide (PEG-4MAL, MW 20 kDa, Biochempeg), bisthiol-PEG (MW 1 kDa ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Daphne Bazopoulou, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Worms were mounted on objective slides using 4 μl thermoreversible CyGEL (BioStatus; Fisher Scientific) and 2 μl of 50 mM levamisole for immobilization ...
-
No products found
because this supplier's products are not listed.
Mengqi Luo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... overnight at 4 °C and then HRP-conjugated secondary antibody (1:2000, ZEN BIO, China) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... Proteins were separated by SDS-PAGE on 4-20 % gradient precast gel (EZBiolab Precast Gel, WSHT, Shanghai) at 100 V for 75 min ...
-
No products found
because this supplier's products are not listed.
Xiuting Liu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and three doses of clodronate-containing liposomes (Liposoma; 200 μL/each on days 4, 11, and 18). Control mice were treated with same doses/volume of IgG (clone HRPN ...
-
No products found
because this supplier's products are not listed.
Frédérica Schyrr, et al.,
bioRxiv - Cell Biology 2023
Quote:
... split in two 4.25 Gy doses 4 h apart using an RS-2000 X-ray irradiator (RAD SOURCE). Transplanted cells were administered the day following irradiation via tail-vein injection ...
-
No products found
because this supplier's products are not listed.
Yoko Kagohashi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The band at the 0-4% Ficoll interface was collected using a Piston Gradient Fractionator (BioComp Instruments, Inc). The vacuolar fraction was stored at -75°C ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
4-Hydroxy-2-hexenal (BSA) is a protein conjugated to BSA.
Cat# abx675028-100UG,
100 µg USD $797.5
Ask
Michaela Frolikova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... diluted 1:50 in 1% BSA in PBS and rabbit polyclonal anti-Folate receptor 4 (Juno) (abx102438, Abbexa, UK) diluted 1:50 in 1% BSA in PBS followed by 1 hr ...
-
No products found
because this supplier's products are not listed.
Aruna Pal, Abantika Pal, Pradyumna Baviskar,
bioRxiv - Genomics 2020
Quote:
Nucleotide variation for the proteins was detected from their nucleotide sequencing and amino acid variations were estimated (DNASTAR). 3D structure of the derived protein was estimated for both indigenous ducks and chicken by Pymol software ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Nydia Tejeda-Muñoz, Edward M. De Robertis,
bioRxiv - Developmental Biology 2022
Quote:
... In vitro synthesized mRNAs were microinjected in a 4 nl volume using an IM 300 Microinjector (Narishige International USA, Inc). To study the role of ESCRT in development ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
Hyeree Park, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Aliquots of 1 mL of each solution was cast in a 4 mL Wheaton Omni-Vial® (DWK Life Sciences, USA). Human ACL fibroblast-osteoblast seeded ADCs were cultured for 14 days tethered ...
-
No products found
because this supplier's products are not listed.
Alan P. R. Lorenzetti, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Cell pellets were resuspended in Milli-Q water and disrupted at 4°C using ceramic beads (Mo Bio Laboratories) and a Precellys 24 homogenizer (Bertin Corp). Protein content was determined by bicinchoninic acid assay (BCA ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Coralie Zangarelli, et al.,
bioRxiv - Genomics 2022
Quote:
A peptide corresponding to PgmL1 amino acid sequence 1 to 266 and carrying a C-terminal His tag was used for guinea pig immunization (Proteogenix). Sera were purified by antigen affinity purification to obtain highly specific α−PgmL1-GP antibodies (0.8 mg/mL) ...
-
No products found
because this supplier's products are not listed.
Brett E. Johnson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Immunofluorescence analyses of tumor tissue: FFPE human tissues were sectioned at 4 μm and mounted on adhesive slides (Mercedes Medical, TNR WHT45AD). The slides were baked overnight in an oven at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Pierre-Emmanuel Y. N’Guetta, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Sections were incubated for 30 min in blocking solution (ice-cold PBS solution with 4% donkey serum (Equitech-Bio, Cat#SD30-0100), 1% bovine serum albumin (Fishersci ...
-
No products found
because this supplier's products are not listed.
Ava Niazi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Antibody to TECTA was raised to peptides based on the predicted amino acid sequence of the mouse TECTA protein (CYNKNPLDDFLRPDGR) and was purified by antigen specific affinity purification by Abfrontier (www.gwvitek.com). The purified antibody (1 mg/ml ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
Cat# F4,
USD $18.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Shisong Fang, et al.,
bioRxiv - Microbiology 2020
Quote:
... Salicylic acid was purchased from J&K Scientific Ltd ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Shikha Yadav, et al.,
bioRxiv - Cell Biology 2023
Quote:
Day 7 BMDMs were washed twice to remove traces of FCS and then incubated in starvation medium from Cell applications Inc ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...