-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
D.K. Wilton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and a micromanipulator MM33 (Pipette.com 3-000-024-R). Mice were subsequently allowed to recover on a warm plate before being transferred back to their home cage ...
-
No products found
because this supplier's products are not listed.
Marek M. Drozdz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and blocked in 3% bovine serum albumin (Proliant Biologicals, #68100) for one hour ...
-
No products found
because this supplier's products are not listed.
Yan Zou, Tian Chi,
bioRxiv - Cancer Biology 2021
Quote:
PBMCs from healthy donors were purchased from HemaCare (PB009C-3). To generate IKZF3-deficient CAR-T cells ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
Cat# ACT-AVM3000-2,
USD $39.29/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Margaret M. McDaniel, Vitaly V. Ganusov,
bioRxiv - Immunology 2019
Quote:
... We fitted either recirculation model (panels A&C, see eqns. (3)–(9) ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Holly Linley, et al.,
bioRxiv - Immunology 2022
Quote:
... placed in 3 µm transwell inserts with 10 µg/ml anti-CD200R1 (OX131, Absolute Antibody), or rat IgG1 isotype control (eBioscience ...
-
Cat# F3,
USD $18.00/EA
Ask
Bocheng Yin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The stock solution of 0.5 M biotin-dPEG®3-benzophenone (biotin-BP, 10267, Quanta BioDesign) in anhydrous DMSO (89139-666 ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Sylvia Mutinda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the seeds were pre-germinated by adding 3 ml of 0.1 ppm GR24 (Chiralix, Nijmegen, Netherlands) and incubating overnight at 30 °C.
-
3-Cyano-7-ethoxycoumarin is a small molecule which can act as a Cytochrom P450 Fluorescent...
Cat# abx282329-10MG,
10 mg USD $166.75
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Mary E. Herndon, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and Background Buster (Innovex Biosciences; Richmond, CA) was used to block non-specific staining ...
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Safwan K. Elkhatib, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and plasma were assessed using 3-CAT research ELISA (Rocky Mountain Diagnostics, BAE-5600, Colorado Springs, CO, USA) which had a corrected NE lower limit of detection of 30 pg/mL ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Ruikang Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the wells were washed 3 times with 250 μl of PBS + 0.05% Tween 20 (PBS-T, Accurate Chemical) and plates were blocked with 200 μl PBS-T + 5% Nonfat Dry Milk for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Susan D’Costa, Matthew J. Rich, Brian O. Diekman,
bioRxiv - Bioengineering 2019
Quote:
... with TRIzol™ and homogenized at 6500 rpm × 30 seconds for 3 cycles (Precellys® 24, Bertin Corp). Protein concentration was determined using the Micro BCA Protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
X. Zhao, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Then the membranes were blocked for 1hr with 3% (w/v) non-fat dry milk (LabScientific Inc., Highlands, NJ). After washing with phosphate-buffered saline plus 0.1% of Tween-20 (PBST) ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Nao Nishida-Aoki, Taranjit S. Gujral,
bioRxiv - Cancer Biology 2021
Quote:
Jurkat cells were washed with PBS and seeded onto a 24-well transwell culture insert with 3 µm pores (Celltreat Scientific Products ...
-
No products found
because this supplier's products are not listed.
Sujatha Muralidharan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A normal tissue TMA consisting of different organ specimens from 3 unique individuals was sourced from US Biomax (Cat# FDA999w1).
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Sonali Singh, et al.,
bioRxiv - Microbiology 2020
Quote:
... After washing three times with PBS blocking was carried out by adding 50 µl of 3% (w/v) bovine serum albumin (BSA) (80400-100, Alpha diagnostics) prepared in PBS ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Guneet Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary human cerebral cortex microvascular endothelial cells (Passage 3, 12 CPD in vitro, ACBRI 376) were procured from Cell Systems (Kirkland, WA 98034, USA). Brain microvascular endothelial cells (BMECs ...