-
No products found
because this supplier's products are not listed.
Noelia Lozano-Vidal, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ...
-
No products found
because this supplier's products are not listed.
Aleksandra Luginina, et al.,
bioRxiv - Biophysics 2023
Quote:
... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
No products found
because this supplier's products are not listed.
Yuan Weng, et al.,
bioRxiv - Cell Biology 2023
Quote:
N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
No products found
because this supplier's products are not listed.
MG Booty, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Caspase 3/7 indicator dye (Sartorius, Germany) and propidium iodide (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Ruddi Rodríguez-García, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1-oleoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl}-sn-glycero-3-phosphocoline (NBD-PC) were purchased from Avanti Polar Lipids. Cholesterol was purchased from Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Ludovica Iovino, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were incubated for 10 min at 37 °C in the presence of 10 µM 2-amino-5,6,7,8-tetrahydro-4-(4-methoxyphenyl)-7-(naphthalen-1-yl)-5-oxo-4H-chromene-3-carbonitrile (UCPH-101; Abcam 120309, UK), a specific excitatory amino acid transporter 1 (EAAT1/Glast ...
-
No products found
because this supplier's products are not listed.
Keriman Sekerci, et al.,
bioRxiv - Plant Biology 2022
Quote:
... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
No products found
because this supplier's products are not listed.
Mégane Brusson, et al.,
bioRxiv - Genetics 2022
Quote:
... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
No products found
because this supplier's products are not listed.
Hyungsoo Kim, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and V5-tag (7/4, Biolegend).
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Niclas Nordholt, et al.,
bioRxiv - Microbiology 2022
Quote:
... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
No products found
because this supplier's products are not listed.
Kazuki Yoshizumi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Geetika Aggarwal, et al.,
bioRxiv - Biochemistry 2020
Quote:
... N-octyl-β-D-glucoside (NOG) and 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin were obtained from Cayman Chemicals. Standard protein molecular weight marker was purchased from Invitrogen ...
-
No products found
because this supplier's products are not listed.
Gemma Molinaro, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Then 10% of the lysate was set aside for use as an input control and the rest was tumbled overnight at 4°C with 7 µl of ERα antibody or 1.4 µg of Homer antibody (Santa Cruz Biotechnology, D-3). The same isotype IgG was used as control for the specificity of the ERα (Abcam #ab172730 ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using pulled borosilicate glass pipettes (4-7 MΩ resistance, Sutter Instrument) filled with an internal solution (in mM ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
Muriel Sébastien, et al.,
bioRxiv - Cell Biology 2024
Quote:
... They were grown for 3-7 days in BrainPhys basal media (#05790, Stemcell Technologies), supplemented with SM1 (#05711 ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Robin W. Yeo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 7 days prior to intracardiac perfusion with 4% paraformaldehyde (PFA) (Electron Microscopy Sciences, 15714) in PBS ...
-
No products found
because this supplier's products are not listed.
Alexander M. Horspool, et al.,
bioRxiv - Microbiology 2021
Quote:
... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ...
-
No products found
because this supplier's products are not listed.
Kirsten Lex, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 4 and 7 days-post injection using a fluorescent stereoscope (Leica M205FA). Transplanted larvae were kept in individual wells of a 6 well-plate to allow individual tracking of melanoma progression ...
-
No products found
because this supplier's products are not listed.
May Zaw Thin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Moritz Hunkeler, Cyrus Y. Jin, Eric S. Fischer,
bioRxiv - Molecular Biology 2022
Quote:
pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
No products found
because this supplier's products are not listed.
Anna C. Dragon, et al.,
bioRxiv - Immunology 2023
Quote:
... with 3% human serum (c.c.pro; CTL medium) supplemented with 12.5 ng/ml IL-7 and IL-15 (PeproTech). On day 1 ...
-
No products found
because this supplier's products are not listed.
Zhe Zhang, Jay R. Gibson, Kimberly M. Huber,
bioRxiv - Neuroscience 2021
Quote:
... Whole cell recordings of L2/3 and L5 pyramidal neurons were obtained using borosilicate pipettes (4-7 MΩ) and a Multiclamp 700A amplifier (Molecular Devices). Internal solution contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Colleen E. O’Connor, et al.,
bioRxiv - Bioengineering 2023
Quote:
Primary human umbilical vein endothelial cells (HUVECs; Lonza; passages 4 to 7) were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2 ...
-
No products found
because this supplier's products are not listed.
Eszter Somogyi, et al.,
bioRxiv - Immunology 2020
Quote:
... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Constanza Salinas-Rebolledo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Alexander S. Zhovmer, et al.,
bioRxiv - Biophysics 2023
Quote:
Equimolar mixture of 3-amino-2-fluorobenzotrifluoride (Combi-Blocks, Cat#QA-4188) and 2,6-dichloro-4-isocyanatopyridine (Toronto Research Chemicals, cat#159178-03-7) were stirred and heated in anhydrous Toluene at 85°C overnight ...
-
No products found
because this supplier's products are not listed.
Weihua Zhou, et al.,
bioRxiv - Neuroscience 2020
Quote:
... C.B-17 SCID mice (female, 4-7 weeks old) were obtained from Envigo and maintained in specific pathogen-free conditions ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Z-RLRGG-7-amino-4-methyl-courmarin (peptide-AMC) was purchased from Bachem. Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC ...
-
No products found
because this supplier's products are not listed.
Jenni Schulz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with this number based on power analysis for a mixed-effects analysis at the group-level.45 Pilot-data from two preliminary studies were used for the power calculation (three subjects (2M/1F 28 ± 4 yrs) and 7 subjects (3M/4F 25 ±4 yrs)).43 ...
-
No products found
because this supplier's products are not listed.
Nicolas Broguiere, et al.,
bioRxiv - Bioengineering 2019
Quote:
7-diethylamino 4-methylcoumarin (DEAC, 2a) was purchased from TCI Deutschland GmbH.
-
No products found
because this supplier's products are not listed.
Thomas Williams, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3-4 μl were mounted on a SuperFrost microscope slide (VWR; 631-0847), covered with a glass cover slip (VWR ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
Cat# HY-N7641-1 mg,
1 mg, USD $200.0
Ask
Janin Knop, et al.,
bioRxiv - Immunology 2019
Quote:
... 7% (v/v) SCF from CHO/SCF conditioned medium and 1μM 4-hydroxytamoxifen (4-OHT, MedChemExpress)(Wicki et al. ...
-
No products found
because this supplier's products are not listed.
Lamuk Zaveri, Jyotsna Dhawan,
bioRxiv - Cell Biology 2021
Quote:
... Klf4 or Oct-3/4 or Klf4 + Oct-3/4 or Klf4 + OctER using PEI (Polysciences, USA). Self-ligated empty pGEM-T vector (Promega ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Trinh Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...