1 - 50 of 737
suppliers found for
7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-W010130-100 mg, 100 mg, USD $50.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... and 0.1 mM IBMX (3,7-dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dione) (Sigma Aldrich)) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Pathology 2022Quote: ... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions. -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0215188Quote: ... 8MM-IBMX (3-Isobutyl-8-(methoxymethyl)-1-methyl-1H-purine-2,6(3H,7H)-dione) was purchased from Santa Cruz Biotechnology (Dallas ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017, published in Clinical Epigenetics doi: 10.1186/s13148-017-0391-xQuote: ... SiRNAs against Nipbl (Nipbl-1: 5’-GTGGTCGTTACCGAAACCGAA-3’; Nipbl-2: 5’-AAGGCAGTACTTAGACTTTAA-3’) and Rad21 (5’-CTCGAGAATGGTAATTGTATA-3’) were made by Qiagen. AllStars Negative Control siRNA was obtained from Qiagen. -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Genetics 2017, published in The FASEB Journal doi: 10.1096/fj.201800242RQuote: ... #1 (5′-CTGAACCACTGCAAGTCTATC-3′) and KDM2B shRNA #2 (5′-CGGCCTTTACAAGAAGACATT-3′) were subcloned into the pLKO.1-puro lentiviral vector (Addgene), according to standard procedures ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Scientific Reports doi: 10.1038/s41598-020-62089-6Quote: ... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Clinical Cancer Research doi: 10.1158/1078-0432.CCR-19-1667Quote: ... and maintained in culture for a total of approximately 2-3 months in DMEM supplemented with 1 ng/mL IL-3 (Peprotech). Mycoplasma testing was not performed ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Molecular Pharmacology doi: 10.1124/mol.119.117069Quote: ... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... (Cat. N° 487910) and 3-amino,4-aminomethyl-2’,7’-difluorofluorescein (DAF-FM) (Cat. N° 251515) were obtained from Calbiochem (San Diego, CA, USA). EZ-link HPDP-Biotin (Cat ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ... -
Polysciences
No products found because this supplier's products are not listed.Cited in Striatin 3 and MAP4K4 cooperate towards oncogenic growth and tissue invasion in medulloblastomabioRxiv - Cancer Biology 2022Quote: ... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in DNAJB1-PRKACA in HEK293T cells induces LINC00473 overexpression that depends on PKA signalingbioRxiv - Cancer Biology 2021Quote: Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2018Quote: ... VX-702 {6-[(aminocarbonyl)(2,6-difluorophenyl)amino]-2-(2,4-difluorophenyl)-3-pyridinecarboxamide} was purchased from Cayman Chemical (Ann Arbor, MI) and E6446{6-[3-(pyrrolidin-1-yl)propoxy)-2-(4-(3-(pyrrolidin-1-yl)propoxy)phenyl]benzo[d]oxazole} was generously provided by Eisai Inc (Tokyo ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Redox protein Memo1 coordinates FGF23-driven signaling and small Rho-GTPases in the mouse kidneybioRxiv - Biochemistry 2020Quote: ... and then immobilized in 7 cm IPG strips (pH 3-10 : 70×3×0.5 mm) and a linear gradient (NL) (GE Healthcare Immobiline™ Dry Strip IPG ... -
Phenomenex
No products found because this supplier's products are not listed.Cited in FlashPack: Fast and simple preparation of ultra-high performance capillary columns for LC-MSbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.tir118.000953Quote: ... Luna 2 C18 3 μm (Phenomenex), Zorbax SB-C18 1.8 μm (Agilent) ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2020Quote: ... 1-(3-(Dimethylamino)propyl)-3-ethylcarboiimide hydrochloride (EDC-HCL; 0.5 g, 2.6 mmol, 1.02 equiv., VWR) and NHS-ester (0.65 g ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2018, published in GigaScience doi: 10.1093/gigascience/giy126Quote: ... we used microscopy system 3 (Leica DMi8, Table 2). -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ... -
World Precision Instruments
No products found because this supplier's products are not listed.Cited in Sensory Stimulation-Induced Astrocytic Calcium Signaling in Electrically Silent Ischemic PenumbrabioRxiv - Neuroscience 2019, published in Frontiers in Aging Neuroscience doi: 10.3389/fnagi.2019.00223Quote: A glass micropipette (1–3 MΩ impedance; 2-μm tip; World Precision Instruments) was connected to a pneumatic injector (3–20 PSI ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ... -
Alfa Aesar
No products found because this supplier's products are not listed.Cited in Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA) -
Eurogentec
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec). -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ... -
Sartorius
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Nature Communications doi: 10.1038/s41467-020-18020-8Quote: ... Caspase-3/7 green apoptosis assay reagent (Sartorius #4440) was added to the cells and transferred to Incucyte® ZOOM 2FLR system and analyzed using 2016 an integrated software. -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cell Reports doi: 10.1016/j.celrep.2020.107538Quote: ... with medium changes every 2-3 days and passages 1-2 times per week using ReLeSR (Stem Cell Technologies). Heteroplasmy levels were regularly measured to insure they were retained across passage numbers ... -
Worthington Biochemical
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...Cat# LS004183, 5 gm, $825.0 AskbioRxiv - Cell Biology 2021Quote: ... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-[3-(dimethylamino)propyl]-carbodiimide (EDC) was purchased from TCI EUROPE (Eschborn ... -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Methods doi: 10.1038/s41592-019-0581-xQuote: ... Wide-field images (Fig.1, 2, 3, 5, 6) were acquired with a 4× objective (Olympus XLFluor 4x/340a); high-resolution images (Fig ...